ABAT | GeneID:479856 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 479856 Official Symbol ABAT
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description 4-aminobutyrate aminotransferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 542

ID Symbol Protein Species
GeneID:18 ABAT NP_000654.2 Homo sapiens
GeneID:40188 CG7433 NP_649168.2 Drosophila melanogaster
GeneID:81632 Abat NP_112265.1 Rattus norvegicus
GeneID:177897 gta-1 NP_501862.1 Caenorhabditis elegans
GeneID:268860 Abat NP_766549.2 Mus musculus
GeneID:378968 abat NP_958906.1 Danio rerio
GeneID:416642 ABAT XP_414940.2 Gallus gallus
GeneID:453903 ABAT XP_001137090.1 Pan troglodytes
GeneID:479856 ABAT XP_851424.1 Canis lupus familiaris
GeneID:506219 ABAT XP_582638.2 Bos taurus
GeneID:852902 UGA1 NP_011533.1 Saccharomyces cerevisiae
GeneID:1270119 AgaP_AGAP006966 XP_308791.2 Anopheles gambiae
GeneID:2542494 SPAC19D5.07 NP_594905.1 Schizosaccharomyces pombe
GeneID:2679339 MGG_01662 XP_363736.1 Magnaporthe grisea
GeneID:2713300 NCU08998.1 XP_331390.1 Neurospora crassa
GeneID:2895485 KLLA0F20548g XP_456003.1 Kluyveromyces lactis
GeneID:4622915 AGOS_AGL050C NP_986616.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_536981 XP_536981
2 XM_846331 XP_851424

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000030230 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSCAFT00000030230 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSCAFT00000030230 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSCAFT00000030230 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSCAFT00000030230 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENSCAFT00000030230 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSCAFT00000030230 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene