AARS | GeneID:479656 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 479656 Official Symbol AARS
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alanyl-tRNA synthetase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1213

ID Symbol Protein Species
GeneID:16 AARS NP_001596.2 Homo sapiens
GeneID:34156 Aats-ala NP_523511.2 Drosophila melanogaster
GeneID:171985 ars-2 NP_491281.1 Caenorhabditis elegans
GeneID:234734 Aars NP_666329.2 Mus musculus
GeneID:292023 Aars XP_214690.3 Rattus norvegicus
GeneID:324940 aars NP_001037775.1 Danio rerio
GeneID:415668 AARS NP_001005836.1 Gallus gallus
GeneID:454210 AARS XP_001169474.1 Pan troglodytes
GeneID:479656 AARS XP_536788.2 Canis lupus familiaris
GeneID:510933 AARS XP_588170.3 Bos taurus
GeneID:814313 PF13_0354 XP_001350388.1 Plasmodium falciparum
GeneID:841442 ALATS NP_175439.2 Arabidopsis thaliana
GeneID:854513 ALA1 NP_014980.1 Saccharomyces cerevisiae
GeneID:1279087 AgaP_AGAP009701 XP_318757.2 Anopheles gambiae
GeneID:2542031 SPAC23C11.09 NP_593640.1 Schizosaccharomyces pombe
GeneID:2676649 MGG_03607 XP_361064.2 Magnaporthe grisea
GeneID:2713811 NCU02566.1 XP_331765.1 Neurospora crassa
GeneID:2894909 KLLA0F02431g XP_455190.1 Kluyveromyces lactis
GeneID:4348211 Os10g0182000 NP_001064254.1 Oryza sativa
GeneID:4620624 AGOS_ADR363C NP_984459.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_536788 XP_536788
2 XM_856762 XP_861855

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000032047 MI0004754 bta-miR-126 CGUACCGUGAGUAAUAAUGCG
ENSCAFT00000032047 MI0004756 bta-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSCAFT00000032047 MI0005031 bta-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSCAFT00000032047 MI0005033 bta-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSCAFT00000032047 MI0004732 bta-miR-18b UAAGGUGCAUCUAGUGCAGUUA
ENSCAFT00000032047 MI0005038 bta-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENSCAFT00000032047 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSCAFT00000032047 MI0005047 bta-miR-425-5p AUGACACGAUCACUCCCGUUGA
ENSCAFT00000032047 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSCAFT00000032047 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENSCAFT00000032047 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSCAFT00000032047 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENSCAFT00000032047 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENSCAFT00000032047 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENSCAFT00000032047 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENSCAFT00000032047 MI0003136 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENSCAFT00000032047 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSCAFT00000032047 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSCAFT00000032047 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000032047 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSCAFT00000032047 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENSCAFT00000032047 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENSCAFT00000032047 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSCAFT00000032047 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENSCAFT00000032047 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENSCAFT00000032047 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENSCAFT00000032047 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSCAFT00000032047 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENSCAFT00000032047 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENSCAFT00000032047 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSCAFT00000032047 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSCAFT00000032047 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSCAFT00000032047 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSCAFT00000032047 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENSCAFT00000032047 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSCAFT00000032047 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSCAFT00000032047 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSCAFT00000032047 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA
ENSCAFT00000032047 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene