ABHD2 | GeneID:479037 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 479037 Official Symbol ABHD2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23121

ID Symbol Protein Species
GeneID:11057 ABHD2 NP_008942.3 Homo sapiens
GeneID:33532 CG3488 NP_608751.2 Drosophila melanogaster
GeneID:54608 Abhd2 NP_061281.3 Mus musculus
GeneID:293050 Abhd2 XP_214979.2 Rattus norvegicus
GeneID:393888 abhd2a NP_957208.1 Danio rerio
GeneID:415493 ABHD2 XP_413866.2 Gallus gallus
GeneID:467753 ABHD2 XP_523148.2 Pan troglodytes
GeneID:479037 ABHD2 XP_849732.1 Canis lupus familiaris
GeneID:508717 ABHD2 NP_001015549.1 Bos taurus
GeneID:559290 abhd2b NP_001073145.1 Danio rerio
GeneID:1277482 ENSANGG00000004955 XP_316894.2 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_536188 XP_536188
2 XM_844639 XP_849732
3 XM_854569 XP_859662

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000018377 MI0004754 bta-miR-126 CGUACCGUGAGUAAUAAUGCG
ENSCAFT00000018377 MI0004738 bta-miR-151 CUAGACUGAAGCUCCUUGAGG
ENSCAFT00000018377 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSCAFT00000018377 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSCAFT00000018377 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000018377 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000018377 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSCAFT00000018377 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSCAFT00000018377 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENSCAFT00000018377 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSCAFT00000018377 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSCAFT00000018377 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSCAFT00000018377 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSCAFT00000018377 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSCAFT00000018377 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSCAFT00000018377 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSCAFT00000018377 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSCAFT00000018377 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSCAFT00000018377 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENSCAFT00000018377 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENSCAFT00000018377 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSCAFT00000018377 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSCAFT00000018377 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSCAFT00000018377 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENSCAFT00000018377 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000018377 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000018377 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSCAFT00000018377 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSCAFT00000018377 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA
ENSCAFT00000018377 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENSCAFT00000036148 MI0004754 bta-miR-126 CGUACCGUGAGUAAUAAUGCG
ENSCAFT00000036148 MI0004737 bta-miR-148a UCAGUGCACUACAGAACUUUGU
ENSCAFT00000036148 MI0005030 bta-miR-148b UCAGUGCAUCACAGAACUUUGU
ENSCAFT00000036148 MI0004738 bta-miR-151 CUAGACUGAAGCUCCUUGAGG
ENSCAFT00000036148 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSCAFT00000036148 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSCAFT00000036148 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000036148 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000036148 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSCAFT00000036148 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSCAFT00000036148 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENSCAFT00000036148 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENSCAFT00000036148 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSCAFT00000036148 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSCAFT00000036148 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSCAFT00000036148 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSCAFT00000036148 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSCAFT00000036148 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSCAFT00000036148 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSCAFT00000036148 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSCAFT00000036148 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSCAFT00000036148 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSCAFT00000036148 MI0005563 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU
ENSCAFT00000036148 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSCAFT00000036148 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENSCAFT00000036148 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000036148 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000036148 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSCAFT00000036148 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene