ABCB6 | GeneID:478914 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 478914 Official Symbol ABCB6
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 6
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11375

ID Symbol Protein Species
GeneID:10058 ABCB6 NP_005680.1 Homo sapiens
GeneID:41925 CG4225 NP_650503.1 Drosophila melanogaster
GeneID:74104 Abcb6 NP_076221.1 Mus musculus
GeneID:140669 Abcb6 NP_542149.1 Rattus norvegicus
GeneID:176540 hmt-1 NP_001022812.1 Caenorhabditis elegans
GeneID:459959 ABCB6 XP_001161097.1 Pan troglodytes
GeneID:478914 ABCB6 XP_536073.2 Canis lupus familiaris
GeneID:564067 abcb6 XP_692515.3 Danio rerio
GeneID:783257 ABCB6 XP_001251072.1 Bos taurus
GeneID:812037 PF14_0455 XP_001348629.1 Plasmodium falciparum
GeneID:1269280 AgaP_AGAP002278 XP_307900.2 Anopheles gambiae
GeneID:2675723 MGG_05190 XP_359587.2 Magnaporthe grisea
GeneID:2704167 NCU00010.1 XP_322096.1 Neurospora crassa
GeneID:3361134 hmt1 NP_588371.2 Schizosaccharomyces pombe

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_536073 XP_536073

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000024031 MI0005005 bta-miR-106 AAAAGUGCUUACAGUGCAGGUA
ENSCAFT00000024031 MI0005031 bta-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
ENSCAFT00000024031 MI0004740 bta-miR-18a UAAGGUGCAUCUAGUGCAGAUA
ENSCAFT00000024031 MI0004732 bta-miR-18b UAAGGUGCAUCUAGUGCAGUUA
ENSCAFT00000024031 MI0005037 bta-miR-200a UAACACUGUCUGGUAACGAUGUU
ENSCAFT00000024031 MI0005055 bta-miR-200b UAAUACUGCCUGGUAAUGAUG
ENSCAFT00000024031 MI0005038 bta-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENSCAFT00000024031 MI0004741 bta-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSCAFT00000024031 MI0005015 bta-miR-20b CAAAGUGCUCACAGUGCAGGUA
ENSCAFT00000024031 MI0004743 bta-miR-221 AGCUACAUUGUCUGCUGGGUUU
ENSCAFT00000024031 MI0004744 bta-miR-222 AGCUACAUCUGGCUACUGGGU
ENSCAFT00000024031 MI0004733 bta-miR-29a CUAGCACCAUCUGAAAUCGGUUA
ENSCAFT00000024031 MI0005043 bta-miR-29b UAGCACCAUUUGAAAUCAGUGUUU
ENSCAFT00000024031 MI0005044 bta-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSCAFT00000024031 MI0005050 bta-miR-93 CAAAGUGCUGUUCGUGCAGGUA
ENSCAFT00000024031 MI0001644 cfa-miR-429 UAAUACUGUCUGGUAAUGCCGU
ENSCAFT00000024031 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSCAFT00000024031 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSCAFT00000024031 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSCAFT00000024031 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSCAFT00000024031 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSCAFT00000024031 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSCAFT00000024031 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENSCAFT00000024031 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSCAFT00000024031 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENSCAFT00000024031 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSCAFT00000024031 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSCAFT00000024031 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENSCAFT00000024031 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENSCAFT00000024031 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSCAFT00000024031 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENSCAFT00000024031 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSCAFT00000024031 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSCAFT00000024031 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSCAFT00000024031 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSCAFT00000024031 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSCAFT00000024031 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSCAFT00000024031 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSCAFT00000024031 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000024031 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSCAFT00000024031 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSCAFT00000024031 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSCAFT00000024031 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSCAFT00000024031 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSCAFT00000024031 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENSCAFT00000024031 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSCAFT00000024031 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENSCAFT00000024031 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_536073  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene