AAMP | GeneID:478908 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 478908 Official Symbol AAMP
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description angio-associated, migratory cell protein
Chromosome N/A
Also Known As angio-associated migratory cell protein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 846

ID Symbol Protein Species
GeneID:14 AAMP NP_001078.2 Homo sapiens
GeneID:39624 CG5114 NP_648731.1 Drosophila melanogaster
GeneID:176680 Y111B2A.12 NP_499643.1 Caenorhabditis elegans
GeneID:227290 Aamp NP_666222.2 Mus musculus
GeneID:301512 Aamp XP_217441.4 Rattus norvegicus
GeneID:405874 zgc:85939 NP_998103.1 Danio rerio
GeneID:459940 AAMP XP_001154321.1 Pan troglodytes
GeneID:478908 AAMP NP_001013872.1 Canis lupus familiaris
GeneID:767919 AAMP NP_001070463.1 Bos taurus
GeneID:769880 AAMP XP_001233195.1 Gallus gallus
GeneID:843514 AT1G71840 NP_177329.2 Arabidopsis thaliana
GeneID:1268314 ENSANGG00000011272 XP_306869.2 Anopheles gambiae
GeneID:1278314 AgaP_AGAP011387 XP_317937.2 Anopheles gambiae
GeneID:2542715 SPAC25H1.08c NP_593812.1 Schizosaccharomyces pombe
GeneID:4333750 Os03g0685600 NP_001050927.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001013850 NP_001013872

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000023220 MI0005462 bta-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSCAFT00000023220 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSCAFT00000023220 MI0005469 bta-miR-99b CACCCGUAGAACCGACCUUGCG
ENSCAFT00000023220 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSCAFT00000023220 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSCAFT00000023220 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENSCAFT00000023220 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSCAFT00000023220 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENSCAFT00000023220 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSCAFT00000023220 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSCAFT00000023220 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENSCAFT00000023220 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENSCAFT00000023220 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSCAFT00000023220 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSCAFT00000023220 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSCAFT00000023220 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENSCAFT00000023220 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENSCAFT00000023220 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSCAFT00000023220 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENSCAFT00000023220 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSCAFT00000023220 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSCAFT00000023220 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSCAFT00000023220 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSCAFT00000023220 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSCAFT00000023220 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSCAFT00000023220 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENSCAFT00000023220 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSCAFT00000023220 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSCAFT00000023220 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSCAFT00000023220 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSCAFT00000023220 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSCAFT00000023220 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSCAFT00000023220 MI0005759 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC
ENSCAFT00000023220 MI0000250 mmu-miR-207 GCUUCUCCUGGCUCUCCUCCCUC
ENSCAFT00000023220 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSCAFT00000023220 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSCAFT00000023220 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSCAFT00000023220 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSCAFT00000023220 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENSCAFT00000023220 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSCAFT00000023220 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSCAFT00000023220 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSCAFT00000023220 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000023220 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000023220 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000023220 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSCAFT00000023220 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSCAFT00000023220 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSCAFT00000023220 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSCAFT00000023220 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENSCAFT00000023220 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lowe JK, et al. (2003) "Linkage mapping of the primary disease locus for collie eye anomaly." Genomics. 82(1):86-95. PMID:12809679