ABCF3 | GeneID:478651 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 478651 Official Symbol ABCF3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family F (GCN20), member 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22784

ID Symbol Protein Species
GeneID:27406 Abcf3 NP_038880.1 Mus musculus
GeneID:40131 CG9330 NP_649129.1 Drosophila melanogaster
GeneID:55324 ABCF3 NP_060828.2 Homo sapiens
GeneID:175873 abcf-3 NP_498339.1 Caenorhabditis elegans
GeneID:287982 Abcf3 NP_001011896.1 Rattus norvegicus
GeneID:424950 ABCF3 XP_422757.2 Gallus gallus
GeneID:460884 ABCF3 XP_516910.2 Pan troglodytes
GeneID:478651 ABCF3 XP_859024.1 Canis lupus familiaris
GeneID:530975 ABCF3 XP_001252189.1 Bos taurus
GeneID:842763 ATGCN3 NP_176636.1 Arabidopsis thaliana
GeneID:850561 GCN20 NP_116664.1 Saccharomyces cerevisiae
GeneID:1267735 ENSANGG00000000043 XP_306294.2 Anopheles gambiae
GeneID:1280669 AgaP_AGAP012005 XP_320530.2 Anopheles gambiae
GeneID:2540597 SPBC29A3.09c NP_595837.1 Schizosaccharomyces pombe
GeneID:2705213 NCU04051.1 XP_323370.1 Neurospora crassa
GeneID:2896717 KLLA0A10857g XP_451473.1 Kluyveromyces lactis
GeneID:4331217 Os02g0826500 NP_001048587.1 Oryza sativa
GeneID:4621026 AGOS_AEL032W NP_984829.1 Eremothecium gossypii
GeneID:5050704 MGG_11547 XP_001411010.1 Magnaporthe grisea
GeneID:100149614 LOC100149614 XP_001922895.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000019709 MI0005028 bta-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSCAFT00000019709 MI0005069 bta-miR-363 AUUGCACGGUAUCCAUCUGCG
ENSCAFT00000019709 MI0005056 bta-miR-7 UGGAAGACUAGUGAUUUUGUUGUU
ENSCAFT00000019709 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSCAFT00000019709 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSCAFT00000019709 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSCAFT00000019709 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENSCAFT00000019709 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSCAFT00000019709 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENSCAFT00000019709 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSCAFT00000019709 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENSCAFT00000019709 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSCAFT00000019709 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENSCAFT00000019709 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSCAFT00000019709 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENSCAFT00000019709 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSCAFT00000019709 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENSCAFT00000019709 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSCAFT00000019709 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSCAFT00000019709 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSCAFT00000019709 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSCAFT00000019709 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSCAFT00000019709 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENSCAFT00000019709 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENSCAFT00000019709 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSCAFT00000019709 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSCAFT00000019709 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSCAFT00000019709 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENSCAFT00000019709 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSCAFT00000019709 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENSCAFT00000019709 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSCAFT00000019709 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSCAFT00000019709 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSCAFT00000019709 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSCAFT00000019709 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSCAFT00000019709 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSCAFT00000019709 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSCAFT00000019709 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSCAFT00000019709 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSCAFT00000019709 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSCAFT00000019709 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSCAFT00000019709 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSCAFT00000019709 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000019709 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000019709 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENSCAFT00000019709 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENSCAFT00000019709 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC
ENSCAFT00000019709 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene