ABCC5 | GeneID:478648 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 478648 Official Symbol ABCC5
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21164

ID Symbol Protein Species
GeneID:10057 ABCC5 NP_005679.2 Homo sapiens
GeneID:27416 Abcc5 NP_038818.2 Mus musculus
GeneID:116721 Abcc5 NP_446376.1 Rattus norvegicus
GeneID:181587 mrp-5 NP_510479.1 Caenorhabditis elegans
GeneID:424947 ABCC5 XP_422754.2 Gallus gallus
GeneID:478648 ABCC5 XP_857354.1 Canis lupus familiaris
GeneID:511769 ABCC5 XP_001251891.1 Bos taurus
GeneID:796249 LOC796249 XP_001333981.2 Danio rerio
GeneID:4329047 Os02g0288400 NP_001046583.1 Oryza sativa
GeneID:4329049 Os02g0288700 NP_001046585.1 Oryza sativa

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000019223 MI0005026 bta-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSCAFT00000019223 MI0005455 bta-let-7e UGAGGUAGGAGGUUGUAUAGU
ENSCAFT00000019223 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000019223 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000019223 MI0004752 bta-miR-125a UCCCUGAGACCCUUUAACCUGUG
ENSCAFT00000019223 MI0005011 bta-miR-142 CAUAAAGUAGAAAGCACUAC
ENSCAFT00000019223 MI0004737 bta-miR-148a UCAGUGCACUACAGAACUUUGU
ENSCAFT00000019223 MI0005039 bta-miR-210 ACUGUGCGUGUGACAGCGGCUGA
ENSCAFT00000019223 MI0004761 bta-miR-30b UGUAAACAUCCUACACUCAGCU
ENSCAFT00000019223 MI0005064 bta-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSCAFT00000019223 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000019223 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000019223 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSCAFT00000019223 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSCAFT00000019223 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENSCAFT00000019223 MI0000740 hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENSCAFT00000019223 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSCAFT00000019223 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSCAFT00000019223 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENSCAFT00000019223 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSCAFT00000019223 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENSCAFT00000019223 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENSCAFT00000019223 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENSCAFT00000019223 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSCAFT00000019223 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENSCAFT00000019223 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000019223 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSCAFT00000019223 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENSCAFT00000019223 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSCAFT00000019223 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSCAFT00000019223 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSCAFT00000019223 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSCAFT00000019223 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSCAFT00000019223 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSCAFT00000019223 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSCAFT00000019223 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSCAFT00000019223 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSCAFT00000019223 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene