ABHD10 | GeneID:478561 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 478561 Official Symbol ABHD10
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 10
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10173

ID Symbol Protein Species
GeneID:55347 ABHD10 NP_060864.1 Homo sapiens
GeneID:213012 Abhd10 NP_766099.2 Mus musculus
GeneID:303953 Abhd10 XP_001064579.1 Rattus norvegicus
GeneID:418419 ABHD10 XP_416633.2 Gallus gallus
GeneID:478561 ABHD10 XP_535737.2 Canis lupus familiaris
GeneID:515563 ABHD10 NP_001015606.1 Bos taurus
GeneID:563031 LOC563031 XP_691488.2 Danio rerio
GeneID:568517 wu:fb10b08 XP_696942.2 Danio rerio
GeneID:743016 ABHD10 XP_001154093.1 Pan troglodytes

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_535737 XP_535737

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000016533 MI0005037 bta-miR-200a UAACACUGUCUGGUAACGAUGUU
ENSCAFT00000016533 MI0004743 bta-miR-221 AGCUACAUUGUCUGCUGGGUUU
ENSCAFT00000016533 MI0004744 bta-miR-222 AGCUACAUCUGGCUACUGGGU
ENSCAFT00000016533 MI0004733 bta-miR-29a CUAGCACCAUCUGAAAUCGGUUA
ENSCAFT00000016533 MI0005043 bta-miR-29b UAGCACCAUUUGAAAUCAGUGUUU
ENSCAFT00000016533 MI0005044 bta-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSCAFT00000016533 MI0005020 bta-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSCAFT00000016533 MI0005468 bta-miR-660 UACCCAUUGCAUAUCGGAGCUG
ENSCAFT00000016533 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSCAFT00000016533 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSCAFT00000016533 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSCAFT00000016533 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSCAFT00000016533 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENSCAFT00000016533 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSCAFT00000016533 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENSCAFT00000016533 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSCAFT00000016533 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSCAFT00000016533 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENSCAFT00000016533 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSCAFT00000016533 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSCAFT00000016533 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENSCAFT00000016533 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSCAFT00000016533 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSCAFT00000016533 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSCAFT00000016533 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSCAFT00000016533 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_535737  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene