ABCG2 | GeneID:478472 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 478472 Official Symbol ABCG2
Locus N/A Gene Type protein-coding
Synonyms BCRP
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 2
Chromosome N/A
Also Known As ATP-binding cassette protein G2; breast cancer resistance protein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55852

ID Symbol Protein Species
GeneID:9429 ABCG2 NP_004818.2 Homo sapiens
GeneID:26357 Abcg2 NP_036050.1 Mus musculus
GeneID:312382 Abcg2 NP_852046.1 Rattus norvegicus
GeneID:423767 ABCG2 XP_421638.2 Gallus gallus
GeneID:471251 ABCG2 XP_526633.2 Pan troglodytes
GeneID:478472 ABCG2 XP_535650.2 Canis lupus familiaris
GeneID:536203 ABCG2 NP_001032555.2 Bos taurus
GeneID:735310 abcg2d NP_001036237.1 Danio rerio
GeneID:811826 PF14_0244 XP_001348418.1 Plasmodium falciparum
GeneID:830541 AT5G06530 NP_850781.2 Arabidopsis thaliana
GeneID:850369 ADP1 NP_009937.2 Saccharomyces cerevisiae
GeneID:2679509 MGG_01563 XP_363637.2 Magnaporthe grisea
GeneID:2713604 NCU02544.1 XP_331743.1 Neurospora crassa
GeneID:2892892 KLLA0D04554g XP_453265.1 Kluyveromyces lactis
GeneID:4331674 Os03g0157400 NP_001049014.1 Oryza sativa
GeneID:4621257 AGOS_AER190W NP_985047.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001048021 NP_001041486
2 XM_535650 XP_535650

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000015321 MI0004732 bta-miR-18b UAAGGUGCAUCUAGUGCAGUUA
ENSCAFT00000015321 MI0005462 bta-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSCAFT00000015321 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENSCAFT00000015321 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSCAFT00000015321 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSCAFT00000015321 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSCAFT00000015321 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSCAFT00000015321 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSCAFT00000015321 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000015321 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000015321 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000015321 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSCAFT00000015321 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene