ABCC11 | GeneID:478138 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 478138 Official Symbol ABCC11
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 11
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69511

ID Symbol Protein Species
GeneID:85320 ABCC11 NP_115972.2 Homo sapiens
GeneID:473275 ABCC11 XP_001163586.1 Pan troglodytes
GeneID:478138 ABCC11 XP_535314.2 Canis lupus familiaris
GeneID:522437 ABCC11 XP_600718.3 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_535314 XP_535314
2 XM_858602 XP_863695

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000016007 MI0004736 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000016007 MI0005456 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000016007 MI0005009 bta-miR-139 UCUACAGUGCACGUGUCUCCAGU
ENSCAFT00000016007 MI0005042 bta-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSCAFT00000016007 MI0005066 bta-miR-23b AUCACAUUGCCAGGGAUUACCAC
ENSCAFT00000016007 MI0005067 bta-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSCAFT00000016007 MI0004746 bta-miR-27a UUCACAGUGGCUAAGUUCCG
ENSCAFT00000016007 MI0004760 bta-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSCAFT00000016007 MI0004733 bta-miR-29a CUAGCACCAUCUGAAAUCGGUUA
ENSCAFT00000016007 MI0005024 bta-miR-92 UAUUGCACUUGUCCCGGCCUGU
ENSCAFT00000016007 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSCAFT00000016007 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSCAFT00000016007 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENSCAFT00000016007 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSCAFT00000016007 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSCAFT00000016007 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENSCAFT00000016007 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSCAFT00000016007 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSCAFT00000016007 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENSCAFT00000016007 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSCAFT00000016007 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSCAFT00000016007 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSCAFT00000016007 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENSCAFT00000016007 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSCAFT00000016007 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSCAFT00000016007 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENSCAFT00000016007 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENSCAFT00000016007 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene