ABCD2 | GeneID:477643 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 477643 Official Symbol ABCD2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family D (ALD), member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55873

ID Symbol Protein Species
GeneID:225 ABCD2 NP_005155.1 Homo sapiens
GeneID:26874 Abcd2 NP_036124.2 Mus musculus
GeneID:43772 CG2316 NP_726543.1 Drosophila melanogaster
GeneID:84356 Abcd2 NP_203503.1 Rattus norvegicus
GeneID:178527 pmp-4 NP_503105.1 Caenorhabditis elegans
GeneID:417694 ABCD2 XP_415938.2 Gallus gallus
GeneID:466952 ABCD2 XP_522352.2 Pan troglodytes
GeneID:477643 ABCD2 XP_534838.1 Canis lupus familiaris
GeneID:1281041 AgaP_AGAP002071 XP_320975.2 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_534838 XP_534838
2 XM_859591 XP_864684
3 XM_859613 XP_864706

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000015953 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSCAFT00000015953 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene