A1CF | GeneID:477581 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 477581 Official Symbol A1CF
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description APOBEC1 complementation factor
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16363

ID Symbol Protein Species
GeneID:29974 A1CF NP_620310.1 Homo sapiens
GeneID:69865 A1cf NP_001074543.1 Mus musculus
GeneID:170912 A1cf NP_596891.1 Rattus norvegicus
GeneID:423680 A1CF XP_421561.2 Gallus gallus
GeneID:466076 A1CF XP_001162517.1 Pan troglodytes
GeneID:477581 A1CF XP_534776.2 Canis lupus familiaris
GeneID:562916 a1cf XP_685178.1 Danio rerio
GeneID:613704 A1CF XP_869839.2 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_534776 XP_534776
2 XM_855876 XP_860969
3 XM_855933 XP_861026

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000024715 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSCAFT00000024715 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSCAFT00000024715 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENSCAFT00000024715 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSCAFT00000024715 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSCAFT00000024715 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene