ABCB9 | GeneID:477456 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 477456 Official Symbol ABCB9
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 9
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10491

ID Symbol Protein Species
GeneID:23457 ABCB9 NP_982269.1 Homo sapiens
GeneID:56325 Abcb9 NP_063928.2 Mus musculus
GeneID:63886 Abcb9 NP_071574.1 Rattus norvegicus
GeneID:416834 ABCB9 XP_415125.2 Gallus gallus
GeneID:452335 ABCB9 XP_509453.2 Pan troglodytes
GeneID:477456 ABCB9 XP_849373.1 Canis lupus familiaris
GeneID:570148 DKEY-21K4.3 XP_698681.3 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_534654 XP_534654
2 XM_844280 XP_849373
3 XM_853575 XP_858668

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000012293 MI0004740 bta-miR-18a UAAGGUGCAUCUAGUGCAGAUA
ENSCAFT00000012293 MI0004762 bta-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENSCAFT00000012293 MI0000486 hsa-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSCAFT00000012293 MI0005545 hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU
ENSCAFT00000012293 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000012293 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000012293 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSCAFT00000012293 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENSCAFT00000012293 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENSCAFT00000012293 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSCAFT00000012293 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSCAFT00000012293 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENSCAFT00000012293 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSCAFT00000012293 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSCAFT00000012293 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSCAFT00000012293 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSCAFT00000012293 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSCAFT00000012293 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENSCAFT00000012293 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSCAFT00000012293 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSCAFT00000012293 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENSCAFT00000012293 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSCAFT00000012293 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSCAFT00000012293 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSCAFT00000012293 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSCAFT00000012293 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSCAFT00000012293 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSCAFT00000012293 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSCAFT00000012293 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENSCAFT00000035158 MI0004754 bta-miR-126 CGUACCGUGAGUAAUAAUGCG
ENSCAFT00000035158 MI0005029 bta-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSCAFT00000035158 MI0005035 bta-miR-192 CUGACCUAUGAAUUGACAGCCAG
ENSCAFT00000035158 MI0005016 bta-miR-215 AUGACCUAUGAAUUGACAGACA
ENSCAFT00000035158 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENSCAFT00000035158 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSCAFT00000035158 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSCAFT00000035158 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENSCAFT00000035158 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENSCAFT00000035158 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENSCAFT00000035158 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSCAFT00000035158 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSCAFT00000035158 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSCAFT00000035158 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSCAFT00000035158 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENSCAFT00000035158 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSCAFT00000035158 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENSCAFT00000035158 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene