AADAC | GeneID:477115 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 477115 Official Symbol AADAC
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylacetamide deacetylase (esterase)
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37436

ID Symbol Protein Species
GeneID:13 AADAC NP_001077.2 Homo sapiens
GeneID:57300 Aadac NP_065413.1 Rattus norvegicus
GeneID:67758 Aadac NP_075872.1 Mus musculus
GeneID:425034 AADACL2 XP_422836.2 Gallus gallus
GeneID:460785 AADAC XP_001145851.1 Pan troglodytes
GeneID:477115 AADAC XP_534309.2 Canis lupus familiaris
GeneID:519557 AADAC NP_001069259.1 Bos taurus
GeneID:100148912 LOC100148912 XP_001923714.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_534309 XP_534309

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000013588 MI0005057 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000013588 MI0005451 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000013588 MI0005452 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000013588 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000013588 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000013588 MI0005051 bta-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSCAFT00000013588 MI0004736 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000013588 MI0005456 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000013588 MI0005006 bta-miR-107 AGCAGCAUUGUACAGGGCUAUC
ENSCAFT00000013588 MI0005033 bta-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSCAFT00000013588 MI0004744 bta-miR-222 AGCUACAUCUGGCUACUGGGU
ENSCAFT00000013588 MI0005054 bta-miR-30a-5p UGUAAACAUCCUCGACUGGAAGCU
ENSCAFT00000013588 MI0004761 bta-miR-30b UGUAAACAUCCUACACUCAGCU
ENSCAFT00000013588 MI0005064 bta-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSCAFT00000013588 MI0004747 bta-miR-30d UGUAAACAUCCCCGACUGGAAGCU
ENSCAFT00000013588 MI0005018 bta-miR-30e-5p UGUAAACAUCCUUGACUGGAAGCU
ENSCAFT00000013588 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSCAFT00000013588 MI0000477 hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
ENSCAFT00000013588 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000013588 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000013588 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSCAFT00000013588 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENSCAFT00000013588 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENSCAFT00000013588 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENSCAFT00000013588 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENSCAFT00000013588 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENSCAFT00000013588 MI0003556 hsa-miR-551a GCGACCCACUCUUGGUUUCCA
ENSCAFT00000013588 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENSCAFT00000013588 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSCAFT00000013588 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSCAFT00000013588 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSCAFT00000013588 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENSCAFT00000013588 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENSCAFT00000013588 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSCAFT00000013588 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSCAFT00000013588 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSCAFT00000013588 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSCAFT00000013588 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSCAFT00000013588 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_534309  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene