ABHD12 | GeneID:477004 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 477004 Official Symbol ABHD12
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 12
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22910

ID Symbol Protein Species
GeneID:26090 ABHD12 NP_001035937.1 Homo sapiens
GeneID:37200 CG15111 NP_611397.1 Drosophila melanogaster
GeneID:76192 Abhd12 NP_077785.1 Mus musculus
GeneID:179172 Y97E10AL.2 NP_505054.1 Caenorhabditis elegans
GeneID:421249 ABHD12 NP_001012889.1 Gallus gallus
GeneID:477004 ABHD12 XP_534202.2 Canis lupus familiaris
GeneID:499913 Abhd12 NP_001019485.1 Rattus norvegicus
GeneID:767657 abhd12 NP_001070065.1 Danio rerio
GeneID:768242 ABHD12 XP_001253369.1 Bos taurus
GeneID:1268858 ENSANGG00000010983 XP_307433.2 Anopheles gambiae
GeneID:1280498 ENSANGG00000011561 XP_320345.2 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_534202 XP_534202

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000007062 MI0005039 bta-miR-210 ACUGUGCGUGUGACAGCGGCUGA
ENSCAFT00000007062 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSCAFT00000007062 MI0005069 bta-miR-363 AUUGCACGGUAUCCAUCUGCG
ENSCAFT00000007062 MI0005046 bta-miR-423 AAGCUCGGUCUGAGGCCCCUCAGU
ENSCAFT00000007062 MI0005049 bta-miR-455 UAUGUGCCUUUGGACUACAUC
ENSCAFT00000007062 MI0005022 bta-miR-487a AAUCAUACAGGGACAUCCAGU
ENSCAFT00000007062 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSCAFT00000007062 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSCAFT00000007062 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSCAFT00000007062 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENSCAFT00000007062 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENSCAFT00000007062 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENSCAFT00000007062 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSCAFT00000007062 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENSCAFT00000007062 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSCAFT00000007062 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSCAFT00000007062 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSCAFT00000007062 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENSCAFT00000007062 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENSCAFT00000007062 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSCAFT00000007062 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENSCAFT00000007062 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSCAFT00000007062 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENSCAFT00000007062 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSCAFT00000007062 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSCAFT00000007062 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENSCAFT00000007062 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENSCAFT00000007062 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_534202  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene