ABCE1 | GeneID:475454 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 475454 Official Symbol ABCE1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family E (OABP), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2205

ID Symbol Protein Species
GeneID:6059 ABCE1 NP_001035809.1 Homo sapiens
GeneID:24015 Abce1 NP_056566.2 Mus musculus
GeneID:39027 CG5651 NP_648272.1 Drosophila melanogaster
GeneID:176733 abce-1 NP_499717.1 Caenorhabditis elegans
GeneID:361390 Abce1 XP_001064797.1 Rattus norvegicus
GeneID:406324 abce1 NP_998216.1 Danio rerio
GeneID:422462 ABCE1 NP_001006440.1 Gallus gallus
GeneID:461523 ABCE1 XP_517465.1 Pan troglodytes
GeneID:475454 ABCE1 XP_532679.2 Canis lupus familiaris
GeneID:514991 ABCE1 XP_592921.3 Bos taurus
GeneID:813912 MAL13P1.344 XP_001350392.1 Plasmodium falciparum
GeneID:827661 ATRLI2 NP_193656.2 Arabidopsis thaliana
GeneID:851665 RLI1 NP_010376.1 Saccharomyces cerevisiae
GeneID:1269374 AgaP_AGAP002182 XP_308004.2 Anopheles gambiae
GeneID:2539753 SPBC14F5.06 NP_596732.1 Schizosaccharomyces pombe
GeneID:2677986 MGG_11382 XP_362155.2 Magnaporthe grisea
GeneID:2712409 NCU03061.1 XP_330497.1 Neurospora crassa
GeneID:2891913 KLLA0C17556g XP_452984.1 Kluyveromyces lactis
GeneID:4350692 Os11g0546000 NP_001068062.1 Oryza sativa
GeneID:4623093 AGOS_AGR125W NP_986791.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_532679 XP_532679
2 XM_862098 XP_867191
3 XM_862108 XP_867201
4 XM_862119 XP_867212

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000012170 MI0005453 bta-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSCAFT00000012170 MI0004736 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000012170 MI0005456 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000012170 MI0005006 bta-miR-107 AGCAGCAUUGUACAGGGCUAUC
ENSCAFT00000012170 MI0005460 bta-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSCAFT00000012170 MI0005461 bta-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSCAFT00000012170 MI0005037 bta-miR-200a UAACACUGUCUGGUAACGAUGUU
ENSCAFT00000012170 MI0004733 bta-miR-29a CUAGCACCAUCUGAAAUCGGUUA
ENSCAFT00000012170 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSCAFT00000012170 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSCAFT00000012170 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSCAFT00000012170 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSCAFT00000012170 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSCAFT00000012170 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSCAFT00000012170 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000012170 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000012170 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSCAFT00000012170 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSCAFT00000012170 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENSCAFT00000012170 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENSCAFT00000012170 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENSCAFT00000012170 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENSCAFT00000012170 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSCAFT00000012170 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSCAFT00000012170 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSCAFT00000012170 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSCAFT00000012170 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSCAFT00000012170 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSCAFT00000012170 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSCAFT00000012170 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSCAFT00000012170 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENSCAFT00000012170 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSCAFT00000012170 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSCAFT00000012170 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSCAFT00000012170 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000012170 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000012170 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSCAFT00000012170 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENSCAFT00000012170 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSCAFT00000012170 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENSCAFT00000012170 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSCAFT00000012170 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSCAFT00000012170 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENSCAFT00000012170 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSCAFT00000012170 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSCAFT00000012170 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSCAFT00000012170 MI0004664 mmu-miR-694 CUGAAAAUGUUGCCUGAAG
ENSCAFT00000012170 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSCAFT00000012170 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSCAFT00000012170 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENSCAFT00000012170 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSCAFT00000012170 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene