AARS2 | GeneID:474920 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 474920 Official Symbol AARS2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alanyl-tRNA synthetase 2, mitochondrial (putative)
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56897

ID Symbol Protein Species
GeneID:57505 AARS2 NP_065796.1 Homo sapiens
GeneID:224805 Aars2 NP_941010.2 Mus musculus
GeneID:301254 Aars2 XP_236942.4 Rattus norvegicus
GeneID:421436 RCJMB04_28n18 NP_001026227.1 Gallus gallus
GeneID:462733 AARS2 XP_518510.2 Pan troglodytes
GeneID:474920 AARS2 XP_532155.2 Canis lupus familiaris
GeneID:786099 AARS2 XP_001253240.1 Bos taurus
GeneID:792787 si:dkey-240e12.1 XP_001332388.2 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_532155 XP_532155

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000003150 MI0005052 bta-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENSCAFT00000003150 MI0005032 bta-miR-181c AACAUUCAACCUGUCGGUGAGUUU
ENSCAFT00000003150 MI0004749 bta-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSCAFT00000003150 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSCAFT00000003150 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENSCAFT00000003150 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENSCAFT00000003150 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSCAFT00000003150 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSCAFT00000003150 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENSCAFT00000003150 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSCAFT00000003150 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSCAFT00000003150 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSCAFT00000003150 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSCAFT00000003150 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSCAFT00000003150 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENSCAFT00000003150 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSCAFT00000003150 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000003150 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_532155  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene