ABCF1 | GeneID:474826 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 474826 Official Symbol ABCF1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family F (GCN20), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 849

ID Symbol Protein Species
GeneID:23 ABCF1 NP_001020262.1 Homo sapiens
GeneID:32112 CG1703 NP_572736.1 Drosophila melanogaster
GeneID:85493 Abcf1 XP_001062137.1 Rattus norvegicus
GeneID:179748 abcf-1 NP_506192.1 Caenorhabditis elegans
GeneID:224742 Abcf1 NP_038882.1 Mus musculus
GeneID:406467 abcf1 NP_998351.1 Danio rerio
GeneID:462543 ABCF1 NP_001035838.1 Pan troglodytes
GeneID:474826 ABCF1 XP_532056.2 Canis lupus familiaris
GeneID:525343 ABCF1 XP_603695.3 Bos taurus
GeneID:824619 ATGCN4 NP_567001.1 Arabidopsis thaliana
GeneID:1280440 AgaP_AGAP012249 XP_320293.2 Anopheles gambiae
GeneID:2539509 SPCC825.01 NP_588051.1 Schizosaccharomyces pombe
GeneID:4333216 Os03g0441500 NP_001050461.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_532056 XP_532056

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000000632 MI0004753 bta-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSCAFT00000000632 MI0005457 bta-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSCAFT00000000632 MI0004733 bta-miR-29a CUAGCACCAUCUGAAAUCGGUUA
ENSCAFT00000000632 MI0005043 bta-miR-29b UAGCACCAUUUGAAAUCAGUGUUU
ENSCAFT00000000632 MI0005044 bta-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSCAFT00000000632 MI0005049 bta-miR-455 UAUGUGCCUUUGGACUACAUC
ENSCAFT00000000632 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENSCAFT00000000632 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSCAFT00000000632 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSCAFT00000000632 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSCAFT00000000632 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENSCAFT00000000632 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSCAFT00000000632 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSCAFT00000000632 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSCAFT00000000632 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSCAFT00000000632 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSCAFT00000000632 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSCAFT00000000632 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSCAFT00000000632 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENSCAFT00000000632 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSCAFT00000000632 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENSCAFT00000000632 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSCAFT00000000632 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000000632 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000000632 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSCAFT00000000632 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENSCAFT00000000632 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSCAFT00000000632 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_532056  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene