ABCG8 | GeneID:474571 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 474571 Official Symbol ABCG8
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 8
Chromosome N/A
Also Known As ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23361

ID Symbol Protein Species
GeneID:64241 ABCG8 NP_071882.1 Homo sapiens
GeneID:67470 Abcg8 NP_080456.1 Mus musculus
GeneID:155192 Abcg8 NP_569098.2 Rattus norvegicus
GeneID:421402 ABCG8 XP_419458.2 Gallus gallus
GeneID:470363 ABCG8 XP_525745.2 Pan troglodytes
GeneID:474571 ABCG8 XP_531799.2 Canis lupus familiaris
GeneID:508829 ABCG8 NP_001019834.1 Bos taurus
GeneID:814660 AT2G01320 NP_178241.1 Arabidopsis thaliana
GeneID:854080 YOL075C NP_014567.1 Saccharomyces cerevisiae
GeneID:2682022 MGG_10410 XP_366191.1 Magnaporthe grisea
GeneID:2892176 KLLA0C04477g XP_452398.1 Kluyveromyces lactis
GeneID:4326045 Os01g0121700 NP_001041878.1 Oryza sativa
GeneID:100136850 abcg8 NP_001108041.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_531799 XP_531799

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000003971 MI0005029 bta-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSCAFT00000003971 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSCAFT00000003971 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSCAFT00000003971 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSCAFT00000003971 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSCAFT00000003971 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSCAFT00000003971 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSCAFT00000003971 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSCAFT00000003971 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSCAFT00000003971 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSCAFT00000003971 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSCAFT00000003971 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENSCAFT00000003971 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSCAFT00000003971 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENSCAFT00000003971 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSCAFT00000003971 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000003971 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000003971 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_531799  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene