ABCC11 | GeneID:473275 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 473275 Official Symbol ABCC11
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 11
Chromosome N/A
Also Known As ATP-binding cassette, sub-family C, member 11
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69511

ID Symbol Protein Species
GeneID:85320 ABCC11 NP_115972.2 Homo sapiens
GeneID:473275 ABCC11 XP_001163586.1 Pan troglodytes
GeneID:478138 ABCC11 XP_535314.2 Canis lupus familiaris
GeneID:522437 ABCC11 XP_600718.3 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001163474 XP_001163474
2 XM_001163586 XP_001163586
3 XM_001163624 XP_001163624
4 XM_528645 XP_528645

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000044137 MI0000477 hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
ENSPTRT00000044137 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENSPTRT00000044137 MI0000809 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENSPTRT00000044137 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSPTRT00000044137 MI0000298 hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENSPTRT00000044137 MI0000299 hsa-miR-222 AGCUACAUCUGGCUACUGGGU
ENSPTRT00000044137 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENSPTRT00000044137 MI0000790 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENSPTRT00000044137 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENSPTRT00000044137 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENSPTRT00000044137 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENSPTRT00000044137 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSPTRT00000044137 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSPTRT00000044137 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENSPTRT00000044137 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENSPTRT00000044137 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSPTRT00000044137 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSPTRT00000044137 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSPTRT00000044137 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENSPTRT00000044137 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENSPTRT00000044137 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENSPTRT00000044137 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSPTRT00000044137 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSPTRT00000044137 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSPTRT00000044137 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSPTRT00000044137 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSPTRT00000044137 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENSPTRT00000044137 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENSPTRT00000044137 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSPTRT00000044137 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSPTRT00000044137 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSPTRT00000044137 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENSPTRT00000044137 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENSPTRT00000044137 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSPTRT00000044137 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENSPTRT00000044137 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSPTRT00000044137 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSPTRT00000044137 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENSPTRT00000044137 MI0002933 ptr-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSPTRT00000044137 MI0002633 ptr-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENSPTRT00000044137 MI0003072 ptr-miR-25 CAUUGCACUUGUCUCGGCUGA
ENSPTRT00000044137 MI0002641 ptr-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSPTRT00000044137 MI0008589 ptr-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSPTRT00000044137 MI0003000 ptr-miR-92 UAUUGCACUUGUCCCGGCCUGU
ENSPTRT00000044137 MI0003114 ptr-miR-92 UAUUGCACUUGUCCCGGCCUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]