ABCB11 | GeneID:470717 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 470717 Official Symbol ABCB11
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 11
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74509

ID Symbol Protein Species
GeneID:8647 ABCB11 NP_003733.2 Homo sapiens
GeneID:27413 Abcb11 NP_066302.2 Mus musculus
GeneID:470717 ABCB11 XP_526100.2 Pan troglodytes
GeneID:488390 ABCB11 XP_545512.2 Canis lupus familiaris
GeneID:531150 ABCB11 XP_609636.3 Bos taurus
GeneID:570936 LOC570936 XP_699562.3 Danio rerio
GeneID:571189 LOC571189 XP_001923538.1 Danio rerio
GeneID:4324720 Os01g0723800 NP_001044110.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_526100 XP_526100

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000023357 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENSPTRT00000023357 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENSPTRT00000023357 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSPTRT00000023357 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSPTRT00000023357 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSPTRT00000023357 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSPTRT00000023357 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSPTRT00000023357 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENSPTRT00000023357 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSPTRT00000023357 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSPTRT00000023357 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSPTRT00000023357 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSPTRT00000023357 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSPTRT00000023357 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENSPTRT00000023357 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_526100  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]