ABCG8 | GeneID:470363 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 470363 Official Symbol ABCG8
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 8
Chromosome N/A
Also Known As ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2); sterolin 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23361

ID Symbol Protein Species
GeneID:64241 ABCG8 NP_071882.1 Homo sapiens
GeneID:67470 Abcg8 NP_080456.1 Mus musculus
GeneID:155192 Abcg8 NP_569098.2 Rattus norvegicus
GeneID:421402 ABCG8 XP_419458.2 Gallus gallus
GeneID:470363 ABCG8 XP_525745.2 Pan troglodytes
GeneID:474571 ABCG8 XP_531799.2 Canis lupus familiaris
GeneID:508829 ABCG8 NP_001019834.1 Bos taurus
GeneID:814660 AT2G01320 NP_178241.1 Arabidopsis thaliana
GeneID:854080 YOL075C NP_014567.1 Saccharomyces cerevisiae
GeneID:2682022 MGG_10410 XP_366191.1 Magnaporthe grisea
GeneID:2892176 KLLA0C04477g XP_452398.1 Kluyveromyces lactis
GeneID:4326045 Os01g0121700 NP_001041878.1 Oryza sativa
GeneID:100136850 abcg8 NP_001108041.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_525745 XP_525745

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000022104 MI0000442 hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSPTRT00000022104 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENSPTRT00000022104 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENSPTRT00000022104 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENSPTRT00000022104 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENSPTRT00000022104 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSPTRT00000022104 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSPTRT00000022104 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSPTRT00000022104 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSPTRT00000022104 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSPTRT00000022104 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSPTRT00000022104 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSPTRT00000022104 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSPTRT00000022104 MI0003684 hsa-miR-660 UACCCAUUGCAUAUCGGAGUUG
ENSPTRT00000022104 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSPTRT00000022104 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSPTRT00000022104 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENSPTRT00000022104 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSPTRT00000022104 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSPTRT00000022104 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSPTRT00000022104 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSPTRT00000022104 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSPTRT00000022104 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSPTRT00000022104 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSPTRT00000022104 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSPTRT00000022104 MI0002933 ptr-miR-181a* ACCAUCGACCGUUGAUUGUACC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_525745  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]