ABHD1 | GeneID:470337 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 470337 Official Symbol ABHD1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 1
Chromosome N/A
Also Known As alpha/beta hydrolase domain containing protein 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 115638

ID Symbol Protein Species
GeneID:84696 ABHD1 NP_115993.2 Homo sapiens
GeneID:313917 Abhd1 NP_001008520.1 Rattus norvegicus
GeneID:470337 ABHD1 XP_525719.2 Pan troglodytes
GeneID:510774 ABHD1 NP_001030266.1 Bos taurus
GeneID:835059 AT5G49950 NP_199806.1 Arabidopsis thaliana
GeneID:2894340 KLLA0E24244g XP_455042.1 Kluyveromyces lactis
GeneID:4619253 AGOS_ABR194C NP_983143.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_525719 XP_525719

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000021887 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSPTRT00000021887 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENSPTRT00000021887 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSPTRT00000021887 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENSPTRT00000021887 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA
ENSPTRT00000021887 MI0002513 ptr-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSPTRT00000021887 MI0002578 ptr-miR-125b UCCCUGAGACCCUAACUUGUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_525719  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]