ACLY | GeneID:47 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 47 Official Symbol ACLY
Locus N/A Gene Type protein-coding
Synonyms ACL; ATPCL; CLATP
Full Name ATP citrate lyase
Description ATP citrate lyase
Chromosome 17q12-q21
Also Known As OTTHUMP00000164773
Summary ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 854

ID Symbol Protein Species
GeneID:47 ACLY NP_001087.2 Homo sapiens
GeneID:24159 Acly NP_058683.1 Rattus norvegicus
GeneID:36760 ATPCL NP_523755.1 Drosophila melanogaster
GeneID:104112 Acly NP_598798.1 Mus musculus
GeneID:179795 B0365.1 NP_506267.1 Caenorhabditis elegans
GeneID:180485 D1005.1 NP_508280.1 Caenorhabditis elegans
GeneID:395373 ACLY NP_001025711.1 Gallus gallus
GeneID:436922 acly NP_001002649.1 Danio rerio
GeneID:454672 ACLY XP_511495.2 Pan troglodytes
GeneID:511135 ACLY NP_001032534.1 Bos taurus
GeneID:607852 ACLY XP_861266.1 Canis lupus familiaris
GeneID:819845 ACLB-1 NP_187317.1 Arabidopsis thaliana
GeneID:835006 ACLB-2 NP_199757.1 Arabidopsis thaliana
GeneID:1279572 AgaP_AGAP010156 XP_319323.2 Anopheles gambiae
GeneID:2539879 SPBC1703.07 NP_596202.1 Schizosaccharomyces pombe
GeneID:2684892 MGG_06719 XP_370222.1 Magnaporthe grisea
GeneID:2708922 NCU06785.1 XP_327071.1 Neurospora crassa
GeneID:4325777 Os01g0300200 NP_001042817.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab61762 ATP citrate lyase antibody (ab61762); Rabbit polyclonal to ATP citrate lyase
2 abcam ab59297 ATP citrate lyase (phospho S454) antibody (ab59297); Rabbit polyclonal to ATP citrate lyase (phospho S454)
3 abcam ab53007 ATP citrate lyase antibody [EP737Y] (ab53007); Rabbit monoclonal [EP737Y] to ATP citrate lyase
4 abcam ab46796 ATP citrate lyase (phospho S455) antibody [EP828Y] (ab46796); Rabbit monoclonal [EP828Y] to ATP citrate lyase (phospho S455)
5 abcam ab40793 ATP citrate lyase antibody [EP704Y] (ab40793); Rabbit monoclonal [EP704Y] to ATP citrate lyase
6 acris AP17083PU-N ATP-citrate synthase (N-term); antibody Ab
7 acris AP01794PU-N ATP-citrate synthase pSer454; antibody Ab
8 acris AP17082PU-N ATP-citrate synthase (C-term); antibody Ab
9 scbt ACLY ACLY Antibody / ACLY Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACLY Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACLY Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0009346 Component citrate lyase complex
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0005524 Function ATP binding
GO:0003878 Function ATP citrate synthase activity
GO:0008815 Function citrate (pro-3S)-lyase activity
GO:0000287 Function magnesium ion binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0004775 Function succinate-CoA ligase (ADP-forming) activity
GO:0016740 Function transferase activity
GO:0006200 Process ATP catabolic process
GO:0044262 Process cellular carbohydrate metabolic process
GO:0006101 Process citrate metabolic process
GO:0015936 Process coenzyme A metabolic process
GO:0008610 Process lipid biosynthetic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001096  UCSC Browser NP_001087
2 NM_198830  UCSC Browser NP_942127

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000352035 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000352035 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000352035 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000352035 MI0000252 hsa-miR-129* AAGCCCUUACCCCAAAAAGUAU
ENST00000352035 MI0000473 hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENST00000352035 MI0000071 hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG
ENST00000352035 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000352035 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENST00000352035 MI0000290 hsa-miR-214 ACAGCAGGCACAGACAGGCAGU
ENST00000352035 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENST00000352035 MI0000088 hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENST00000352035 MI0000749 hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENST00000352035 MI0000805 hsa-miR-342-5p AGGGGUGCUAUCUGUGAUUGA
ENST00000352035 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000352035 MI0005566 hsa-miR-374b AUAUAAUACAACCUGCUAAGUG
ENST00000352035 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000352035 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000352035 MI0003556 hsa-miR-551a GCGACCCACUCUUGGUUUCCA
ENST00000352035 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENST00000352035 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000352035 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENST00000352035 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000352035 MI0005543 hsa-miR-708* CAACUAGACUGUGAGCUUCUAG
ENST00000352035 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000352035 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000352035 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000352035 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000352035 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENST00000352035 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENST00000352035 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENST00000352035 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate results in decreased expression of ACLY mRNA
17522070
Acetaminophen
  • Acetaminophen results in decreased expression of ACLY mRNA
17522070
Acetaminophen
  • Acetaminophen affects the expression of ACLY mRNA
17562736
Aluminum
  • Aluminum results in increased expression of and results in increased activity of ACLY protein
17762189
Benzene
  • Benzene affects the expression of ACLY mRNA
15878777
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ACLY mRNA
17522070
Clofibrate
  • Clofibrate results in decreased expression of ACLY mRNA
17522070
Corn Oil
  • Corn Oil affects the expression of ACLY mRNA
16360708
coumarin
  • coumarin affects the expression of ACLY mRNA
16963487
Dexamethasone
  • Dexamethasone results in decreased expression of ACLY mRNA
17522070
Dietary Fats
  • Dietary Fats results in decreased expression of ACLY mRNA
18042831
Erythromycin Estolate
  • Erythromycin Estolate results in decreased expression of ACLY mRNA
17522070
Ethanol
  • [Fish Oils co-treated with Ethanol] results in increased expression of ACLY mRNA
17347304
Ethanol
  • Ethanol results in increased expression of ACLY mRNA
16946407
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ACLY mRNA
17108234, 15953391
Fish Oils
  • [Fish Oils co-treated with Ethanol] results in increased expression of ACLY mRNA
17347304
Flavonoids
  • Flavonoids results in increased expression of ACLY mRNA
18035473
hydroxyhydroquinone
  • hydroxyhydroquinone results in increased expression of ACLY mRNA
17572062
Indomethacin
  • Indomethacin affects the expression of ACLY mRNA
17546600
Lindane
  • Lindane results in decreased expression of ACLY mRNA
17785943
Methylnitrosourea
  • Methylnitrosourea results in increased expression of ACLY mRNA
16525678
Mifepristone
  • Mifepristone results in increased expression of ACLY mRNA
17584828
Naloxone
  • Naloxone results in decreased expression of ACLY mRNA
17522070
palm oil
  • palm oil results in decreased expression of ACLY mRNA
18042831
Propyl Gallate
  • Propyl Gallate affects the expression of ACLY mRNA
18539377
Testosterone
  • Testosterone results in increased expression of ACLY mRNA
16579987
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of ACLY mRNA
16054898
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in decreased expression of ACLY mRNA
18295293
Tetracycline
  • Tetracycline results in decreased expression of ACLY mRNA
17522070

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Antisocial Personality Disorder inferred via Testosterone 7506515
Breast Neoplasms inferred via Testosterone 17261762
Firesetting Behavior inferred via Testosterone 7506515
Glioblastoma inferred via Testosterone 17162496
Hirsutism inferred via Testosterone 17019078
Hyperandrogenism inferred via Testosterone 17019078
Hypopituitarism inferred via Testosterone 17426086
Impulse Control Disorders inferred via Testosterone 7506515
Sexual Dysfunction, Physiological inferred via Testosterone 16631401
Pruritus inferred via Naloxone 15861022
Endometriosis inferred via Mifepristone 16134523
Ovarian Neoplasms inferred via Mifepristone 16525653
Adenocarcinoma inferred via Methylnitrosourea 15688392, 15113128
Breast Neoplasms inferred via Methylnitrosourea 16253758
Cataract inferred via Methylnitrosourea 12484553
Fibrosarcoma inferred via Methylnitrosourea 11555667
Glioma inferred via Methylnitrosourea 9825942
Limb Deformities, Congenital inferred via Methylnitrosourea 15526292
Lower Extremity Deformities, Congenital inferred via Methylnitrosourea 16080182
Lung Neoplasms inferred via Methylnitrosourea 18062963
Lymphoma inferred via Methylnitrosourea 11418001, 16257854
Lymphoma, B-Cell inferred via Methylnitrosourea 14633661
Mammary Neoplasms, Experimental inferred via Methylnitrosourea 16619500, 12931682, 10767621, 10838139, 16944150, 16051031, 15113128, 11751437, 15688392, 16827153, 14999141, 17131329, 17020996, 11807958, 15313902
Neoplasms inferred via Methylnitrosourea 15533788
Neoplasms, Experimental inferred via Methylnitrosourea 12696579
Neurilemmoma inferred via Methylnitrosourea 11555667
Pancreatic Neoplasms inferred via Methylnitrosourea 16965848
Prostatic Neoplasms inferred via Methylnitrosourea 15682402, 12376480
Retinal Degeneration inferred via Methylnitrosourea 18155124, 18172121
Retinoblastoma inferred via Methylnitrosourea 11555667
Stomach Neoplasms inferred via Methylnitrosourea 18593901, 16257854, 15930296
Thymus Neoplasms inferred via Methylnitrosourea 11418001
Agricultural Workers' Diseases inferred via Lindane 12661182
Breast Neoplasms inferred via Lindane 14688026
Neoplasms inferred via Lindane 16818664, 12807735
Prostatic Neoplasms inferred via Lindane 14688026, 12661182
Seizures inferred via Lindane 7539098
Adenoma inferred via Indomethacin 11497255
Alzheimer Disease inferred via Indomethacin 15579461
Breast Neoplasms inferred via Indomethacin 17401462
Carcinoma, Hepatocellular inferred via Indomethacin 16391822
Colonic Neoplasms inferred via Indomethacin 11260862, 15786552, 15963497
Colorectal Neoplasms inferred via Indomethacin 18059344, 12606626, 17054584
Duodenal Ulcer inferred via Indomethacin 17045617, 16699067, 17202747
Edema inferred via Indomethacin 8985016
Enteritis inferred via Indomethacin 16328016
Esophageal Neoplasms inferred via Indomethacin 11005569
Glioblastoma inferred via Indomethacin 12870263
Hyperlipidemias inferred via Indomethacin 17546600
Ileal Diseases inferred via Indomethacin 10574470
Intestinal Diseases inferred via Indomethacin 15610444, 10210152, 17329856, 15831440
Jejunal Diseases inferred via Indomethacin 10574470
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via Indomethacin 10785260
Leukemia, Myeloid, Acute inferred via Indomethacin 18360721
Lung Neoplasms inferred via Indomethacin 11497255
Pain inferred via Indomethacin 17440234
Stomach Diseases inferred via Indomethacin 17207306
Stomach Ulcer inferred via Indomethacin 16934674, 10878458, 18299717, 15104355, 12077510, 17654042, 12467913
Ulcer inferred via Indomethacin 10574470
Inflammation inferred via Flavonoids 17296493
Hypersensitivity, Delayed inferred via Fish Oils 11484837
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16105132, 11677210, 15861022, 17333356, 16919318, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Burns inferred via Ethanol 16374292
Carcinoma, Hepatocellular inferred via Ethanol 15763234, 15289165
Esophageal Neoplasms inferred via Ethanol 16704527
Fatty Liver inferred via Ethanol 16409862
Fatty Liver, Alcoholic inferred via Ethanol 17920746
Fetal Alcohol Syndrome inferred via Ethanol 16946407
Hepatitis, Toxic inferred via Ethanol 11566570
Liver Cirrhosis inferred via Ethanol 15289165
Liver Cirrhosis, Alcoholic inferred via Ethanol 18295389
Liver Cirrhosis, Experimental inferred via Ethanol 18166357
Liver Diseases, Alcoholic inferred via Ethanol 17207112, 17347304
Hepatitis, Toxic inferred via Erythromycin Estolate 17522070
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 16118317, 15744524
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Hypersensitivity, Delayed inferred via Corn Oil 11484837
Dyslipidemias inferred via Clofibrate 16707586
Niemann-Pick Disease, Type C inferred via Clofibrate 9802331
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 16011737, 10355542, 16097048, 15673190, 15700767, 16124888, 16227642
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 15959796, 17595544, 12631006, 12795759, 61145
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 15027814, 15968718, 16227642, 15998439, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 16239168, 17334410, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17525996, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17557913, 17805973, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 18376398, 12389079, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 16248980, 16116963, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 17285989, 15830285, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Anemia, Aplastic inferred via Benzene 14761424, 11369114, 17661222
Bone Marrow Diseases inferred via Benzene 16183116
Breast Neoplasms inferred via Benzene 11921183, 17162533
Dermatitis inferred via Benzene 15902427
Hematologic Diseases inferred via Benzene 16183116
Hypertension inferred via Benzene 17940673
Leukemia inferred via Benzene 15935818, 17119257, 14694614, 18335105
Leukemia, Myeloid inferred via Benzene 17506065
Lung Diseases, Interstitial inferred via Benzene 14698565
Lymphoma inferred via Benzene 17119257, 17584886
Multiple Myeloma inferred via Benzene 17119195
Occupational Diseases inferred via Benzene 17479406, 15935809, 17178637, 15612468, 15913788, 15576619, 16737584, 17119257, 15727169
Thymus Neoplasms inferred via Benzene 10850423
Alzheimer Disease inferred via Aluminum 10721010
Inflammation inferred via Aluminum 16052892
Lung Diseases inferred via Aluminum 16052892
Multiple Sclerosis, Chronic Progressive inferred via Aluminum 17086897
Multiple Sclerosis, Relapsing-Remitting inferred via Aluminum 17086897
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 17562736, 16177239, 15968718, 16227642, 14986274, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
GSK3B GSK3B / ACLY Affinity Capture-MS Ewing RM (2007)
IKBKE IKBKE / ACLY Affinity Capture-MS Ewing RM (2007)
NME2 NME2 / ACLY Affinity Capture-MS Ewing RM (2007)
PRKAB1 PRKAB1 / ACLY Affinity Capture-MS Ewing RM (2007)
TFE3 TFE3 / ACLY Affinity Capture-MS Ewing RM (2007)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Wellen KE, et al. (2009) "ATP-citrate lyase links cellular metabolism to histone acetylation." Science. 324(5930):1076-1080. PMID:19461003
  2. [ + ] Pridgeon JW, et al. (2009) "Proteomic analysis reveals Hrs ubiquitin-interacting motif-mediated ubiquitin signaling in multiple cellular processes." FEBS J. 276(1):118-131. PMID:19019082
  3. [ + ] Migita T, et al. (2008) "ATP citrate lyase: activation and therapeutic implications in non-small cell lung cancer." Cancer Res. 68(20):8547-8554. PMID:18922930
  4. [ + ] Srivastava V, et al. (2008) "Genetic correlates of olanzapine-induced weight gain in schizophrenia subjects from north India: role of metabolic pathway genes." Pharmacogenomics. 9(8):1055-1068. PMID:18681781
  5. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  6. [ + ] Ewing RM, et al. (2007) "Large-scale mapping of human protein-protein interactions by mass spectrometry." Mol Syst Biol. 3():89. PMID:17353931
  7. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  8. [ + ] Rush J, et al. (2005) "Immunoaffinity profiling of tyrosine phosphorylation in cancer cells." Nat Biotechnol. 23(1):94-101. PMID:15592455
  9. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  10. [ + ] Michno A, et al. (2004) "The role of adenosine triphosphate citrate lyase in the metabolism of acetyl coenzyme a and function of blood platelets in diabetes mellitus." Metabolism. 53(1):66-72. PMID:14681844
  11. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  12. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  13. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  14. [ + ] Potapova IA, et al. (2000) "Phosphorylation of recombinant human ATP:citrate lyase by cAMP-dependent protein kinase abolishes homotropic allosteric regulation of the enzyme by citrate and increases the enzyme activity. Allosteric activation of ATP:citrate lyase by phosphorylated sugars." Biochemistry. 39(5):1169-1179. PMID:10653665
  15. [ + ] Lord KA, et al. (1997) "Variant cDNA sequences of human ATP:citrate lyase: cloning, expression, and purification from baculovirus-infected insect cells." Protein Expr Purif. 9(1):133-141. PMID:9116495
  16. [ + ] Couch FJ, et al. (1994) "Localization of the gene for ATP citrate lyase (ACLY) distal to gastrin(GAS) and proximal to D17S856 on chromosome 17q12-q21." Genomics. 21(2):444-446. PMID:8088842
  17. [ + ] Elshourbagy NA, et al. (1992) "Cloning and expression of a human ATP-citrate lyase cDNA." Eur J Biochem. 204(2):491-499. PMID:1371749
  18. [ + ] Ramakrishna S, et al. (1990) "Sequence of sites on ATP-citrate lyase and phosphatase inhibitor 2 phosphorylated by multifunctional protein kinase (a glycogen synthase kinase 3 like kinase)." Biochemistry. 29(33):7617-7624. PMID:2176822
  19. [ + ] Stralfors P, et al. (1987) "Isoproterenol and insulin control the cellular localization of ATP citrate-lyase through its phosphorylation in adipocytes." J Biol Chem. 262(24):11486-11489. PMID:3305493
  20. [ + ] Suzuki M, et al. (1981) "ATP citrate lyase in human adipose tissue." J Nutr Sci Vitaminol (Tokyo). 27(6):595-598. PMID:6801225
  21. [ + ] Szutowicz A, et al. (1980) "Regional and subcellular distribution of ATP-citrate lyase and other enzymes of acetyl-CoA metabolism in rat brain." J Neurochem. 35(4):775-785. PMID:6109001