ABCA7 | GeneID:468639 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 468639 Official Symbol ABCA7
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 7
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_524026 XP_524026

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000018691 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENSPTRT00000018691 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENSPTRT00000018691 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENSPTRT00000018691 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENSPTRT00000018691 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSPTRT00000018691 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSPTRT00000018691 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSPTRT00000018691 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSPTRT00000018691 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSPTRT00000018691 MI0003632 hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU
ENSPTRT00000018691 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENSPTRT00000018691 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENSPTRT00000018691 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSPTRT00000018691 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSPTRT00000018691 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENSPTRT00000018691 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENSPTRT00000018691 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSPTRT00000018691 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSPTRT00000018691 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSPTRT00000018691 MI0002909 ptr-miR-197 UUCACCACCUUCUCCACCCAGC
ENSPTRT00000018691 MI0002838 ptr-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSPTRT00000018691 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_524026  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]