ABHD2 | GeneID:467753 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 467753 Official Symbol ABHD2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23121

ID Symbol Protein Species
GeneID:11057 ABHD2 NP_008942.3 Homo sapiens
GeneID:33532 CG3488 NP_608751.2 Drosophila melanogaster
GeneID:54608 Abhd2 NP_061281.3 Mus musculus
GeneID:293050 Abhd2 XP_214979.2 Rattus norvegicus
GeneID:393888 abhd2a NP_957208.1 Danio rerio
GeneID:415493 ABHD2 XP_413866.2 Gallus gallus
GeneID:467753 ABHD2 XP_523148.2 Pan troglodytes
GeneID:479037 ABHD2 XP_849732.1 Canis lupus familiaris
GeneID:508717 ABHD2 NP_001015549.1 Bos taurus
GeneID:559290 abhd2b NP_001073145.1 Danio rerio
GeneID:1277482 ENSANGG00000004955 XP_316894.2 Anopheles gambiae

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000013695 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSPTRT00000013695 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSPTRT00000013695 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSPTRT00000013695 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENSPTRT00000013695 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSPTRT00000013695 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSPTRT00000013695 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSPTRT00000013695 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSPTRT00000013695 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000013695 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000013695 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000013695 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSPTRT00000013695 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENSPTRT00000013695 MI0002641 ptr-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSPTRT00000013695 MI0008589 ptr-miR-26a UUCAAGUAAUCCAGGAUAGGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]