ABHD13 | GeneID:467322 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 467322 Official Symbol ABHD13
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 13
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6716

ID Symbol Protein Species
GeneID:44441 Bem46 NP_477372.1 Drosophila melanogaster
GeneID:68904 Abhd13 NP_001074588.1 Mus musculus
GeneID:84945 ABHD13 NP_116248.2 Homo sapiens
GeneID:306630 Abhd13 XP_225044.3 Rattus norvegicus
GeneID:418763 ABHD13 NP_001008681.1 Gallus gallus
GeneID:467322 ABHD13 XP_001135541.1 Pan troglodytes
GeneID:513848 ABHD13 XP_878914.1 Bos taurus
GeneID:561333 zgc:123286 NP_001032774.1 Danio rerio
GeneID:832174 WAV2 NP_568395.1 Arabidopsis thaliana
GeneID:855396 YNL320W NP_014079.1 Saccharomyces cerevisiae
GeneID:1275600 AgaP_AGAP008746 XP_314863.2 Anopheles gambiae
GeneID:2540264 bem46 NP_595609.1 Schizosaccharomyces pombe
GeneID:2675206 MGG_00142 XP_369102.2 Magnaporthe grisea
GeneID:2712588 NCU03276.1 XP_330712.1 Neurospora crassa
GeneID:2894644 KLLA0E21065g XP_454899.1 Kluyveromyces lactis
GeneID:4343867 Os07g0608300 NP_001060241.1 Oryza sativa
GeneID:4620051 AGOS_ADL187W NP_983909.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001135450 XP_001135450
2 XM_001135541 XP_001135541

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000011061 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENSPTRT00000011061 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]