A1CF | GeneID:466076 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 466076 Official Symbol A1CF
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description APOBEC1 complementation factor
Chromosome N/A
Also Known As apobec-1 complementation factor
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16363

ID Symbol Protein Species
GeneID:29974 A1CF NP_620310.1 Homo sapiens
GeneID:69865 A1cf NP_001074543.1 Mus musculus
GeneID:170912 A1cf NP_596891.1 Rattus norvegicus
GeneID:423680 A1CF XP_421561.2 Gallus gallus
GeneID:466076 A1CF XP_001162517.1 Pan troglodytes
GeneID:477581 A1CF XP_534776.2 Canis lupus familiaris
GeneID:562916 a1cf XP_685178.1 Danio rerio
GeneID:613704 A1CF XP_869839.2 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001162348 XP_001162348
2 XM_001162517 XP_001162517
3 XM_001162562 XP_001162562
4 XM_521478 XP_521478

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000004691 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSPTRT00000004691 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENSPTRT00000004691 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENSPTRT00000004691 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENSPTRT00000004691 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSPTRT00000004691 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSPTRT00000004691 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSPTRT00000004691 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENSPTRT00000004691 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSPTRT00000004691 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSPTRT00000004691 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENSPTRT00000004691 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENSPTRT00000004691 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENSPTRT00000004691 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENSPTRT00000004691 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENSPTRT00000004691 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSPTRT00000004691 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSPTRT00000004691 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSPTRT00000004691 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSPTRT00000004691 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]