AAMP | GeneID:459940 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 459940 Official Symbol AAMP
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description angio-associated, migratory cell protein
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 846

ID Symbol Protein Species
GeneID:14 AAMP NP_001078.2 Homo sapiens
GeneID:39624 CG5114 NP_648731.1 Drosophila melanogaster
GeneID:176680 Y111B2A.12 NP_499643.1 Caenorhabditis elegans
GeneID:227290 Aamp NP_666222.2 Mus musculus
GeneID:301512 Aamp XP_217441.4 Rattus norvegicus
GeneID:405874 zgc:85939 NP_998103.1 Danio rerio
GeneID:459940 AAMP XP_001154321.1 Pan troglodytes
GeneID:478908 AAMP NP_001013872.1 Canis lupus familiaris
GeneID:767919 AAMP NP_001070463.1 Bos taurus
GeneID:769880 AAMP XP_001233195.1 Gallus gallus
GeneID:843514 AT1G71840 NP_177329.2 Arabidopsis thaliana
GeneID:1268314 ENSANGG00000011272 XP_306869.2 Anopheles gambiae
GeneID:1278314 AgaP_AGAP011387 XP_317937.2 Anopheles gambiae
GeneID:2542715 SPAC25H1.08c NP_593812.1 Schizosaccharomyces pombe
GeneID:4333750 Os03g0685600 NP_001050927.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001154090 XP_001154090
2 XM_001154321 XP_001154321
3 XM_516086 XP_516086

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000023937 MI0000471 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG
ENSPTRT00000023937 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENSPTRT00000023937 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENSPTRT00000023937 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENSPTRT00000023937 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENSPTRT00000023937 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENSPTRT00000023937 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENSPTRT00000023937 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSPTRT00000023937 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSPTRT00000023937 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENSPTRT00000023937 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENSPTRT00000023937 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENSPTRT00000023937 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSPTRT00000023937 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENSPTRT00000023937 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSPTRT00000023937 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENSPTRT00000023937 MI0002469 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC
ENSPTRT00000023937 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENSPTRT00000023937 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENSPTRT00000023937 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSPTRT00000023937 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSPTRT00000023937 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSPTRT00000023937 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSPTRT00000023937 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENSPTRT00000023937 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSPTRT00000023937 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSPTRT00000023937 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENSPTRT00000023937 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSPTRT00000023937 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSPTRT00000023937 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSPTRT00000023937 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSPTRT00000023937 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENSPTRT00000023937 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSPTRT00000023937 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSPTRT00000023937 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSPTRT00000023937 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENSPTRT00000023937 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSPTRT00000023937 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSPTRT00000023937 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENSPTRT00000023937 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSPTRT00000023937 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSPTRT00000023937 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSPTRT00000023937 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENSPTRT00000023937 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSPTRT00000023937 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSPTRT00000023937 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSPTRT00000023937 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000023937 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000023937 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000023937 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSPTRT00000023937 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSPTRT00000023937 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSPTRT00000023937 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENSPTRT00000023937 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSPTRT00000023937 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSPTRT00000023937 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENSPTRT00000023937 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENSPTRT00000023937 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSPTRT00000023937 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENSPTRT00000023937 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSPTRT00000023937 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENSPTRT00000023937 MI0002532 ptr-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSPTRT00000023937 MI0008533 ptr-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSPTRT00000023937 MI0002838 ptr-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSPTRT00000023937 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENSPTRT00000023937 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]