ABCA3 | GeneID:453833 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 453833 Official Symbol ABCA3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 3
Chromosome N/A
Also Known As ATP-binding cassette, sub-family A member 3
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37437

ID Symbol Protein Species
GeneID:21 ABCA3 NP_001080.2 Homo sapiens
GeneID:27410 Abca3 NP_001034670.1 Mus musculus
GeneID:33103 CG1718 NP_608445.1 Drosophila melanogaster
GeneID:178559 abt-4 NP_503175.1 Caenorhabditis elegans
GeneID:302973 Abca3 XP_220219.4 Rattus norvegicus
GeneID:416386 ABCA3 XP_414701.2 Gallus gallus
GeneID:453833 ABCA3 XP_510744.2 Pan troglodytes
GeneID:479879 ABCA3 XP_537004.2 Canis lupus familiaris
GeneID:505787 ABCA3 XP_582132.3 Bos taurus
GeneID:1269722 AgaP_AGAP007504 XP_308371.2 Anopheles gambiae
GeneID:1276992 AgaP_AGAP006379 XP_557048.1 Anopheles gambiae
GeneID:1280527 AgaP_AGAP012156 XP_552044.1 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001162571 XP_001162571
2 XM_510744 XP_510744

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000014106 MI0000261 hsa-miR-139-3p GGAGACGCGGCCCUGUUGGAGU
ENSPTRT00000014106 MI0000261 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENSPTRT00000014106 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSPTRT00000014106 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSPTRT00000014106 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENSPTRT00000014106 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENSPTRT00000014106 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENSPTRT00000014106 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSPTRT00000014106 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSPTRT00000014106 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSPTRT00000014106 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSPTRT00000014106 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSPTRT00000014106 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSPTRT00000014106 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSPTRT00000014106 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSPTRT00000014106 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSPTRT00000014106 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSPTRT00000014106 MI0003205 hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU
ENSPTRT00000014106 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSPTRT00000014106 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSPTRT00000014106 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSPTRT00000014106 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSPTRT00000014106 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSPTRT00000014106 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSPTRT00000014106 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSPTRT00000014106 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSPTRT00000014106 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSPTRT00000014106 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSPTRT00000014106 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSPTRT00000014106 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSPTRT00000014106 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSPTRT00000014106 MI0002904 ptr-miR-224 CAAGUCACUAGUGGUUCCGUUUA
ENSPTRT00000014106 MI0003049 ptr-miR-27a UUCACAGUGGCUAAGUUCCGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]