ABCC4 | GeneID:452625 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 452625 Official Symbol ABCC4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Chromosome N/A
Also Known As ATP-binding cassette, sub-family C, member 4
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74563

ID Symbol Protein Species
GeneID:10257 ABCC4 NP_005836.2 Homo sapiens
GeneID:35163 CG31792 NP_724148.1 Drosophila melanogaster
GeneID:47905 l(2)03659 NP_610482.2 Drosophila melanogaster
GeneID:170924 Abcc4 NP_596902.1 Rattus norvegicus
GeneID:180691 mrp-6 NP_508710.2 Caenorhabditis elegans
GeneID:239273 Abcc4 NP_001028508.1 Mus musculus
GeneID:368620 abcc4 NP_001007039.1 Danio rerio
GeneID:418791 ABCC4 NP_001025990.1 Gallus gallus
GeneID:452625 ABCC4 XP_001137006.1 Pan troglodytes
GeneID:485523 ABCC4 XP_542642.2 Canis lupus familiaris
GeneID:515333 ABCC4 XP_593336.2 Bos taurus
GeneID:820496 ATMRP3 NP_187915.1 Arabidopsis thaliana
GeneID:820497 ATMRP8 NP_187916.3 Arabidopsis thaliana
GeneID:820498 ATMRP7 NP_187917.3 Arabidopsis thaliana
GeneID:4327122 Os01g0173900 NP_001042159.1 Oryza sativa

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000010956 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSPTRT00000010956 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSPTRT00000010956 MI0000812 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENSPTRT00000010956 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSPTRT00000010956 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSPTRT00000010956 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENSPTRT00000010956 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENSPTRT00000010956 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSPTRT00000010956 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSPTRT00000010956 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENSPTRT00000010956 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSPTRT00000010956 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSPTRT00000010956 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSPTRT00000010956 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSPTRT00000010956 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSPTRT00000010956 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENSPTRT00000010956 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSPTRT00000010956 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSPTRT00000010956 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSPTRT00000010956 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSPTRT00000010956 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]