ABCC2 | GeneID:450670 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 450670 Official Symbol ABCC2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68052

ID Symbol Protein Species
GeneID:1244 ABCC2 NP_000383.1 Homo sapiens
GeneID:12780 Abcc2 NP_038834.2 Mus musculus
GeneID:393561 abcc2 NP_956883.1 Danio rerio
GeneID:403632 ABCC2 NP_001003081.1 Canis lupus familiaris
GeneID:423828 ABCC2 XP_421698.2 Gallus gallus
GeneID:450670 ABCC2 XP_507976.2 Pan troglodytes
GeneID:520925 ABCC2 XP_599177.3 Bos taurus
GeneID:818031 ATMRP2 NP_181013.1 Arabidopsis thaliana
GeneID:839920 ATMRP1 NP_001031116.1 Arabidopsis thaliana
GeneID:4337027 Os04g0620000 NP_001053904.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_507976 XP_507976

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000005385 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSPTRT00000005385 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSPTRT00000005385 MI0000234 hsa-miR-192 CUGACCUAUGAAUUGACAGCC
ENSPTRT00000005385 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSPTRT00000005385 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENSPTRT00000005385 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENSPTRT00000005385 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSPTRT00000005385 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENSPTRT00000005385 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSPTRT00000005385 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSPTRT00000005385 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSPTRT00000005385 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSPTRT00000005385 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENSPTRT00000005385 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENSPTRT00000005385 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSPTRT00000005385 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENSPTRT00000005385 MI0003584 hsa-miR-577 UAGAUAAAAUAUUGGUACCUG
ENSPTRT00000005385 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSPTRT00000005385 MI0003622 hsa-miR-609 AGGGUGUUUCUCUCAUCUCU
ENSPTRT00000005385 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENSPTRT00000005385 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSPTRT00000005385 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSPTRT00000005385 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSPTRT00000005385 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSPTRT00000005385 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSPTRT00000005385 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSPTRT00000005385 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSPTRT00000005385 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000005385 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000005385 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000005385 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSPTRT00000005385 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSPTRT00000005385 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSPTRT00000005385 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENSPTRT00000005385 MI0002641 ptr-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSPTRT00000005385 MI0008589 ptr-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSPTRT00000005385 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_507976  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]