a2bp1 | GeneID:449554 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 449554 Official Symbol a2bp1
Locus N/A Gene Type protein-coding
Synonyms zgc:103635
Full Name ataxin 2-binding protein 1
Description ataxin 2-binding protein 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69339

ID Symbol Protein Species
GeneID:54715 A2BP1 NP_665898.1 Homo sapiens
GeneID:268859 A2bp1 NP_899011.1 Mus musculus
GeneID:302920 A2bp1 XP_220155.3 Rattus norvegicus
GeneID:416645 A2BP1 XP_414942.2 Gallus gallus
GeneID:449554 a2bp1 NP_001005596.1 Danio rerio
GeneID:609116 LOC609116 XP_851461.1 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005634 Component nucleus
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0003723 Function RNA binding
GO:0021854 Process hypothalamus development
GO:0006397 Process mRNA processing
GO:0008380 Process RNA splicing

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001005596 NP_001005596

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000055534 MI0001960 dre-miR-101a UACAGUACUGUGAUAACUGAAG
ENSDART00000055534 MI0001961 dre-miR-101b UACAGUACUAUGAUAACUGAAG
ENSDART00000055534 MI0002007 dre-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSDART00000055534 MI0002008 dre-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSDART00000055534 MI0002048 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000055534 MI0002049 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000055534 MI0002179 dre-miR-458 AUAGCUCUUUGAAUGGUACUGC
ENSDART00000055534 MI0002181 dre-miR-460-3p CACAGCGCAUACAAUGUGGAUG
ENSDART00000055534 MI0004784 dre-miR-738 GCUACGGCCCGCGUCGGGACCUC
ENSDART00000055534 MI0001953 dre-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENSDART00000055534 MI0004941 xtr-miR-191 CAACGGAAUCCCAAAAGCAGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kurrasch DM, et al. (2007) "The neonatal ventromedial hypothalamus transcriptome reveals novel markers with spatially distinct patterning." J Neurosci. 27(50):13624-13634. PMID:18077674
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932