acot7 | GeneID:447878 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 447878 Official Symbol acot7
Locus CH211-122N14.1 Gene Type protein-coding
Synonyms zgc:103413
Full Name acyl-CoA thioesterase 7
Description acyl-CoA thioesterase 7
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 15780

ID Symbol Protein Species
GeneID:11332 ACOT7 NP_863654.1 Homo sapiens
GeneID:26759 Acot7 NP_037346.1 Rattus norvegicus
GeneID:70025 Acot7 NP_579926.1 Mus musculus
GeneID:419371 ACOT7 XP_417533.2 Gallus gallus
GeneID:447878 acot7 NP_001004617.1 Danio rerio
GeneID:479589 ACOT7 XP_536727.2 Canis lupus familiaris
GeneID:514788 ACOT7 NP_001069150.1 Bos taurus
GeneID:745616 ACOT7 XP_001155887.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001004617 NP_001004617

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000098404 MI0001876 dre-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSDART00000098404 MI0002023 dre-miR-155 UUAAUGCUAAUCGUGAUAGGGG
ENSDART00000098404 MI0001387 dre-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENSDART00000098404 MI0001388 dre-miR-222 AGCUACAUCUGGCUACUGGGUCUC
ENSDART00000098404 MI0003256 dre-miR-489 AGUGACAUCAUAUGUACGGCUGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932