abhd3 | GeneID:447830 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 447830 Official Symbol abhd3
Locus N/A Gene Type protein-coding
Synonyms zgc:92800
Full Name abhydrolase domain containing 3
Description abhydrolase domain containing 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 14055

ID Symbol Protein Species
GeneID:35930 CG8058 NP_610459.2 Drosophila melanogaster
GeneID:106861 Abhd3 NP_598891.1 Mus musculus
GeneID:171586 ABHD3 NP_612213.2 Homo sapiens
GeneID:180309 Y60A3A.7 NP_507863.1 Caenorhabditis elegans
GeneID:180450 C44C1.5 NP_001024458.1 Caenorhabditis elegans
GeneID:291793 Abhd3 XP_214618.4 Rattus norvegicus
GeneID:421068 ABHD3 XP_419156.2 Gallus gallus
GeneID:447830 abhd3 NP_001004569.1 Danio rerio
GeneID:480177 ABHD3 XP_537301.2 Canis lupus familiaris
GeneID:539795 ABHD3 NP_001069655.1 Bos taurus
GeneID:824243 AT3G50790 NP_190648.1 Arabidopsis thaliana
GeneID:1270246 AgaP_AGAP006819 XP_308926.2 Anopheles gambiae
GeneID:4330156 Os02g0649400 NP_001047583.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001004569 NP_001004569

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000023851 MI0002026 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000023851 MI0003243 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000023851 MI0001903 dre-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSDART00000023851 MI0001904 dre-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSDART00000023851 MI0001905 dre-miR-19c UGUGCAAAUCCAUGCAAAACUCG
ENSDART00000023851 MI0001906 dre-miR-19d UGUGCAAACCCAUGCAAAACUGA
ENSDART00000023851 MI0001379 dre-miR-210* AGCCACUGACUAACGCACAUUG
ENSDART00000023851 MI0001383 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000023851 MI0002050 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000023851 MI0001387 dre-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENSDART00000023851 MI0001388 dre-miR-222 AGCUACAUCUGGCUACUGGGUCUC
ENSDART00000023851 MI0001918 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000023851 MI0001919 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000023851 MI0001920 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000023851 MI0001921 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000023851 MI0001365 dre-miR-34 UGGCAGUGUCUUAGCUGGUUGU
ENSDART00000023851 MI0003690 dre-miR-34b UAGGCAGUGUUGUUAGCUGAUUG
ENSDART00000023851 MI0004774 dre-miR-34c AGGCAGUGCAGUUAGUUGAUUAC
ENSDART00000023851 MI0001527 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002111 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002112 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002113 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002114 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002115 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002116 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002117 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002118 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002119 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002120 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002121 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002122 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002123 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002124 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002125 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002126 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002131 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002132 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002133 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002134 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002135 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0002138 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000023851 MI0001528 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002142 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002143 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002144 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002146 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002147 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002148 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002149 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002150 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002151 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002152 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002153 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002154 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002155 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002156 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002157 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002158 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002166 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002170 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002171 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002172 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002173 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0002174 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000023851 MI0001529 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002079 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002080 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002081 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002082 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002083 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002087 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002088 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002089 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002090 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002091 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002092 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002093 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002094 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002095 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002096 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002097 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002098 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002099 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002100 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002101 dre-miR-430c UAAGUGCUUCUCUUUGGGGUAG
ENSDART00000023851 MI0002139 dre-miR-430i UAAGUGCUAUUUGUUGGCGUAG
ENSDART00000023851 MI0002140 dre-miR-430i UAAGUGCUAUUUGUUGGCGUAG
ENSDART00000023851 MI0002141 dre-miR-430i UAAGUGCUAUUUGUUGGCGUAG
ENSDART00000023851 MI0004878 xtr-miR-302 UAAGUGCUCCAAUGUUUUAGUGG
ENSDART00000023851 MI0004963 xtr-miR-428 UAAGUGCUCUCUAGUUCGGUUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932