abhd11 | GeneID:446169 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 446169 Official Symbol abhd11
Locus N/A Gene Type protein-coding
Synonyms Wbscr21l; wbscr21
Full Name abhydrolase domain containing 11
Description abhydrolase domain containing 11
Chromosome N/A
Also Known As Williams Beuren syndrome chromosome region 21; wbscr21-like
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5961

ID Symbol Protein Species
GeneID:31663 CG2059 NP_572388.1 Drosophila melanogaster
GeneID:68758 Abhd11 NP_660250.1 Mus musculus
GeneID:83451 ABHD11 NP_683710.1 Homo sapiens
GeneID:173096 R05D7.4 NP_493077.1 Caenorhabditis elegans
GeneID:185192 F32B4.6 NP_492942.1 Caenorhabditis elegans
GeneID:360831 Abhd11 XP_341105.1 Rattus norvegicus
GeneID:417473 ABHD11 XP_415721.2 Gallus gallus
GeneID:446169 abhd11 NP_001004290.1 Danio rerio
GeneID:472412 ABHD11 XP_001147903.1 Pan troglodytes
GeneID:489803 ABHD11 XP_546921.1 Canis lupus familiaris
GeneID:510109 ABHD11 NP_001029544.1 Bos taurus
GeneID:686139 LOC686139 XP_001066660.1 Rattus norvegicus
GeneID:810986 PF11_0441 XP_001348110.1 Plasmodium falciparum
GeneID:852919 YGR031W NP_011545.1 Saccharomyces cerevisiae
GeneID:1280255 AgaP_AGAP009289 XP_320086.1 Anopheles gambiae
GeneID:2541745 SPAC22H12.03 NP_593115.1 Schizosaccharomyces pombe
GeneID:2685094 MGG_06921 XP_370424.2 Magnaporthe grisea
GeneID:2709957 NCU01454.1 XP_327893.1 Neurospora crassa
GeneID:2897458 KLLA0B05863g XP_451797.1 Kluyveromyces lactis
GeneID:4619344 AGOS_ACL180C NP_983224.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001004290 NP_001004290

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000101208 MI0001992 dre-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSDART00000101208 MI0001993 dre-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSDART00000101208 MI0001994 dre-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSDART00000101208 MI0001995 dre-miR-133c UUUGGUCCCUUUCAACCAGCUA
ENSDART00000101208 MI0001922 dre-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSDART00000101208 MI0002077 dre-miR-455 UAUGUGCCCUUGGACUACAUCG
ENSDART00000101208 MI0004771 dre-miR-727* UCAGUCUUCAAUUCCUCCCAGC
ENSDART00000101208 MI0004778 dre-miR-733 UGCGUUGGUUUAGCUCAGUGGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Amsterdam A, et al. (2004) "Identification of 315 genes essential for early zebrafish development." Proc Natl Acad Sci U S A. 101(35):12792-12797. PMID:15256591
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932