acads | GeneID:445288 | Danio rerio
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 445288 | Official Symbol | acads |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | wu:fc44c01; zgc:92400 | ||
| Full Name | acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain | ||
| Description | acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain | ||
| Chromosome | N/A | ||
| Also Known As | fc44c01; short-chain acyl-CoA dehydrogenase | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 20057
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:35 | ACADS | NP_000008.1 | Homo sapiens |
| GeneID:11409 | Acads | NP_031409.2 | Mus musculus |
| GeneID:42364 | Arc42 | NP_650840.1 | Drosophila melanogaster |
| GeneID:64304 | Acads | NP_071957.1 | Rattus norvegicus |
| GeneID:416969 | ACADS | NP_001006193.1 | Gallus gallus |
| GeneID:445288 | acads | NP_001003743.1 | Danio rerio |
| GeneID:477517 | ACADS | XP_534712.2 | Canis lupus familiaris |
| GeneID:511222 | ACADS | NP_001029573.1 | Bos taurus |
| GeneID:742921 | ACADS | XP_001162935.1 | Pan troglodytes |
| GeneID:1281174 | AgaP_AGAP001951 | XP_321112.2 | Anopheles gambiae |
| GeneID:100149613 | LOC100149613 | XP_001920717.1 | Danio rerio |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0003995 | Function | acyl-CoA dehydrogenase activity |
| GO:0009055 | Function | electron carrier activity |
| GO:0050660 | Function | FAD binding |
| GO:0016491 | Function | oxidoreductase activity |
| GO:0016627 | Function | oxidoreductase activity, acting on the CH-CH group of donors |
| GO:0008152 | Process | metabolic process |
| GO:0055114 | Process | oxidation reduction |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001003743 | NP_001003743 | |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSDART00000014669 | MI0001877 | dre-miR-1 | UGGAAUGUAAAGAAGUAUGUAU |
| ENSDART00000014669 | MI0001878 | dre-miR-1 | UGGAAUGUAAAGAAGUAUGUAU |
| ENSDART00000014669 | MI0001958 | dre-miR-100 | AACCCGUAGAUCCGAACUUGUG |
| ENSDART00000014669 | MI0001959 | dre-miR-100 | AACCCGUAGAUCCGAACUUGUG |
| ENSDART00000014669 | MI0001972 | dre-miR-125a | UCCCUGAGACCCUUAACCUGUG |
| ENSDART00000014669 | MI0001973 | dre-miR-125a | UCCCUGAGACCCUUAACCUGUG |
| ENSDART00000014669 | MI0001980 | dre-miR-128 | UCACAGUGAACCGGUCUCUUUU |
| ENSDART00000014669 | MI0001981 | dre-miR-128 | UCACAGUGAACCGGUCUCUUUU |
| ENSDART00000014669 | MI0001992 | dre-miR-133a | UUUGGUCCCCUUCAACCAGCUG |
| ENSDART00000014669 | MI0001993 | dre-miR-133a | UUUGGUCCCCUUCAACCAGCUG |
| ENSDART00000014669 | MI0001994 | dre-miR-133b | UUUGGUCCCCUUCAACCAGCUA |
| ENSDART00000014669 | MI0001995 | dre-miR-133c | UUUGGUCCCUUUCAACCAGCUA |
| ENSDART00000014669 | MI0002004 | dre-miR-141 | UAACACUGUCUGGUAACGAUGC |
| ENSDART00000014669 | MI0001897 | dre-miR-17a | CAAAGUGCUUACAGUGCAGGUA |
| ENSDART00000014669 | MI0001898 | dre-miR-17a | CAAAGUGCUUACAGUGCAGGUA |
| ENSDART00000014669 | MI0001901 | dre-miR-18b | UAAGGUGCAUUUAGUGCAGAUA |
| ENSDART00000014669 | MI0004764 | dre-miR-190b | UGAUAUGUUUGAUAUUCGGUUG |
| ENSDART00000014669 | MI0001371 | dre-miR-192 | AUGACCUAUGAAUUGACAGCC |
| ENSDART00000014669 | MI0002029 | dre-miR-193a | AACUGGCCUACAAAGUCCCAGU |
| ENSDART00000014669 | MI0002030 | dre-miR-193a | AACUGGCCUACAAAGUCCCAGU |
| ENSDART00000014669 | MI0002031 | dre-miR-193a | AACUGGCCUACAAAGUCCCAGU |
| ENSDART00000014669 | MI0002032 | dre-miR-193b | AACUGGCCCGCAAAGUCCCGCU |
| ENSDART00000014669 | MI0002037 | dre-miR-200a | UAACACUGUCUGGUAACGAUGU |
| ENSDART00000014669 | MI0001376 | dre-miR-203a | GUGAAAUGUUUAGGACCACUUG |
| ENSDART00000014669 | MI0001907 | dre-miR-20a | UAAAGUGCUUAUAGUGCAGGUAG |
| ENSDART00000014669 | MI0001922 | dre-miR-25 | CAUUGCACUUGUCUCGGUCUGA |
| ENSDART00000014669 | MI0001928 | dre-miR-27a | UUCACAGUGGCUAAGUUCCGCU |
| ENSDART00000014669 | MI0001929 | dre-miR-27b | UUCACAGUGGCUAAGUUCUGCA |
| ENSDART00000014669 | MI0001930 | dre-miR-27c | UUCACAGUGGUUAAGUUCUGC |
| ENSDART00000014669 | MI0001931 | dre-miR-27d | UUCACAGUGGCUAAGUUCUUCA |
| ENSDART00000014669 | MI0001932 | dre-miR-27e | UUCACAGUGGCUAAGUUCAGUG |
| ENSDART00000014669 | MI0002068 | dre-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENSDART00000014669 | MI0002069 | dre-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENSDART00000014669 | MI0002070 | dre-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENSDART00000014669 | MI0002071 | dre-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENSDART00000014669 | MI0002180 | dre-miR-459 | UCAGUAACAAGGAUUCAUCCUG |
| ENSDART00000014669 | MI0004767 | dre-miR-723 | AAGACAUCAAUUAAAUCUGUGCU |
| ENSDART00000014669 | MI0004775 | dre-miR-730 | UCCUCAUUGUGCAUGCUGUGUGU |
| ENSDART00000014669 | MI0004780 | dre-miR-734 | GUAAAUGCUGCAGAAUCGUACCG |
| ENSDART00000014669 | MI0001951 | dre-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENSDART00000014669 | MI0001952 | dre-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENSDART00000014669 | MI0001953 | dre-miR-92b | UAUUGCACUCGUCCCGGCCUCC |
| ENSDART00000014669 | MI0004868 | xtr-miR-215 | AUGACCUAUGAAAUGACAGCC |
| ENSDART00000014669 | MI0004922 | xtr-miR-33a | GUGCAUUGUAGUUGCAUUG |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
Genetic screens in zebrafish (Danio rerio) have identified mutations that define the roles of hundreds of essential vertebrate genes. Genetic maps can link mutant phenotype with gene sequence by providing candidate genes for mutations and polymorphic genetic markers useful in positional cloning projects. Here we report a zebrafish genetic map comprising 4073 polymorphic markers, with more than twice the number of coding sequences localized in previously reported zebrafish genetic maps. We use this map in comparative studies to identify numerous regions of synteny conserved among the genomes of zebrafish, Tetraodon, and human. In addition, we use our map to analyze gene duplication in the zebrafish and Tetraodon genomes. Current evidence suggests that a whole-genome duplication occurred in the teleost lineage after it split from the tetrapod lineage, and that only a subset of the duplicates have been retained in modern teleost genomes. It has been proposed that differential retention of duplicate genes may have facilitated the isolation of nascent species formed during the vast radiation of teleosts. We find that different duplicated genes have been retained in zebrafish and Tetraodon, although similar numbers of duplicates remain in both genomes. Finally, we use comparative mapping data to address the proposal that the common ancestor of vertebrates had a genome consisting of 12 chromosomes. In a three-way comparison between the genomes of zebrafish, Tetraodon, and human, our analysis delineates the gene content for 11 of these 12 proposed ancestral chromosomes.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).