acads | GeneID:445288 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 445288 Official Symbol acads
Locus N/A Gene Type protein-coding
Synonyms wu:fc44c01; zgc:92400
Full Name acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain
Description acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain
Chromosome N/A
Also Known As fc44c01; short-chain acyl-CoA dehydrogenase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 20057

ID Symbol Protein Species
GeneID:35 ACADS NP_000008.1 Homo sapiens
GeneID:11409 Acads NP_031409.2 Mus musculus
GeneID:42364 Arc42 NP_650840.1 Drosophila melanogaster
GeneID:64304 Acads NP_071957.1 Rattus norvegicus
GeneID:416969 ACADS NP_001006193.1 Gallus gallus
GeneID:445288 acads NP_001003743.1 Danio rerio
GeneID:477517 ACADS XP_534712.2 Canis lupus familiaris
GeneID:511222 ACADS NP_001029573.1 Bos taurus
GeneID:742921 ACADS XP_001162935.1 Pan troglodytes
GeneID:1281174 AgaP_AGAP001951 XP_321112.2 Anopheles gambiae
GeneID:100149613 LOC100149613 XP_001920717.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0016491 Function oxidoreductase activity
GO:0016627 Function oxidoreductase activity, acting on the CH-CH group of donors
GO:0008152 Process metabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001003743 NP_001003743

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000014669 MI0001877 dre-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSDART00000014669 MI0001878 dre-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSDART00000014669 MI0001958 dre-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSDART00000014669 MI0001959 dre-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSDART00000014669 MI0001972 dre-miR-125a UCCCUGAGACCCUUAACCUGUG
ENSDART00000014669 MI0001973 dre-miR-125a UCCCUGAGACCCUUAACCUGUG
ENSDART00000014669 MI0001980 dre-miR-128 UCACAGUGAACCGGUCUCUUUU
ENSDART00000014669 MI0001981 dre-miR-128 UCACAGUGAACCGGUCUCUUUU
ENSDART00000014669 MI0001992 dre-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSDART00000014669 MI0001993 dre-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSDART00000014669 MI0001994 dre-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSDART00000014669 MI0001995 dre-miR-133c UUUGGUCCCUUUCAACCAGCUA
ENSDART00000014669 MI0002004 dre-miR-141 UAACACUGUCUGGUAACGAUGC
ENSDART00000014669 MI0001897 dre-miR-17a CAAAGUGCUUACAGUGCAGGUA
ENSDART00000014669 MI0001898 dre-miR-17a CAAAGUGCUUACAGUGCAGGUA
ENSDART00000014669 MI0001901 dre-miR-18b UAAGGUGCAUUUAGUGCAGAUA
ENSDART00000014669 MI0004764 dre-miR-190b UGAUAUGUUUGAUAUUCGGUUG
ENSDART00000014669 MI0001371 dre-miR-192 AUGACCUAUGAAUUGACAGCC
ENSDART00000014669 MI0002029 dre-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSDART00000014669 MI0002030 dre-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSDART00000014669 MI0002031 dre-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSDART00000014669 MI0002032 dre-miR-193b AACUGGCCCGCAAAGUCCCGCU
ENSDART00000014669 MI0002037 dre-miR-200a UAACACUGUCUGGUAACGAUGU
ENSDART00000014669 MI0001376 dre-miR-203a GUGAAAUGUUUAGGACCACUUG
ENSDART00000014669 MI0001907 dre-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSDART00000014669 MI0001922 dre-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSDART00000014669 MI0001928 dre-miR-27a UUCACAGUGGCUAAGUUCCGCU
ENSDART00000014669 MI0001929 dre-miR-27b UUCACAGUGGCUAAGUUCUGCA
ENSDART00000014669 MI0001930 dre-miR-27c UUCACAGUGGUUAAGUUCUGC
ENSDART00000014669 MI0001931 dre-miR-27d UUCACAGUGGCUAAGUUCUUCA
ENSDART00000014669 MI0001932 dre-miR-27e UUCACAGUGGCUAAGUUCAGUG
ENSDART00000014669 MI0002068 dre-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSDART00000014669 MI0002069 dre-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSDART00000014669 MI0002070 dre-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSDART00000014669 MI0002071 dre-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSDART00000014669 MI0002180 dre-miR-459 UCAGUAACAAGGAUUCAUCCUG
ENSDART00000014669 MI0004767 dre-miR-723 AAGACAUCAAUUAAAUCUGUGCU
ENSDART00000014669 MI0004775 dre-miR-730 UCCUCAUUGUGCAUGCUGUGUGU
ENSDART00000014669 MI0004780 dre-miR-734 GUAAAUGCUGCAGAAUCGUACCG
ENSDART00000014669 MI0001951 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000014669 MI0001952 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000014669 MI0001953 dre-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENSDART00000014669 MI0004868 xtr-miR-215 AUGACCUAUGAAAUGACAGCC
ENSDART00000014669 MI0004922 xtr-miR-33a GUGCAUUGUAGUUGCAUUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932