aarsd1 | GeneID:445178 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 445178 Official Symbol aarsd1
Locus N/A Gene Type protein-coding
Synonyms im:7152658; zgc:101066
Full Name alanyl-tRNA synthetase domain containing 1
Description alanyl-tRNA synthetase domain containing 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6821

ID Symbol Protein Species
GeneID:31318 CG10802 NP_570062.1 Drosophila melanogaster
GeneID:69684 Aarsd1 NP_659078.1 Mus musculus
GeneID:80755 AARSD1 NP_079543.1 Homo sapiens
GeneID:420013 AARSD1 XP_001235322.1 Gallus gallus
GeneID:445178 zgc:101066 NP_001003572.1 Danio rerio
GeneID:454704 AARSD1 XP_001157692.1 Pan troglodytes
GeneID:480510 AARSD1 XP_537630.2 Canis lupus familiaris
GeneID:510711 MGC134004 NP_001033162.1 Bos taurus
GeneID:619440 Aarsd1 NP_001029281.1 Rattus norvegicus
GeneID:855688 YNL040W NP_014358.1 Saccharomyces cerevisiae
GeneID:1272786 AgaP_AGAP003413 XP_311697.2 Anopheles gambiae
GeneID:2893329 KLLA0D02794g XP_453192.1 Kluyveromyces lactis

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005524 Function ATP binding
GO:0016876 Function ligase activity, forming aminoacyl-tRNA and related compounds
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001003572 NP_001003572

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000002583 MI0001982 dre-miR-129* AAGCCCUUACCCCAAAAAGCAU
ENSDART00000002583 MI0003692 dre-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSDART00000002583 MI0003364 dre-miR-135b UAUGGCUUUUUAUUCCUAUCUG
ENSDART00000002583 MI0001996 dre-miR-135c UAUGGCUUUCUAUUCCUAUGUG
ENSDART00000002583 MI0001997 dre-miR-135c UAUGGCUUUCUAUUCCUAUGUG
ENSDART00000002583 MI0001998 dre-miR-135c UAUGGCUUUCUAUUCCUAUGUG
ENSDART00000002583 MI0003693 dre-miR-139 UCUACAGUGCAUGUGUCU
ENSDART00000002583 MI0002015 dre-miR-148 UCAGUGCAUUACAGAACUUUGU
ENSDART00000002583 MI0002017 dre-miR-152 UCAGUGCAUGACAGAACUUUGG
ENSDART00000002583 MI0001373 dre-miR-199 CCCAGUGUUCAGACUACCUGUUC
ENSDART00000002583 MI0001374 dre-miR-199 CCCAGUGUUCAGACUACCUGUUC
ENSDART00000002583 MI0001375 dre-miR-199 CCCAGUGUUCAGACUACCUGUUC
ENSDART00000002583 MI0001922 dre-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSDART00000002583 MI0001929 dre-miR-27b UUCACAGUGGCUAAGUUCUGCA
ENSDART00000002583 MI0001930 dre-miR-27c UUCACAGUGGUUAAGUUCUGC
ENSDART00000002583 MI0002067 dre-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENSDART00000002583 MI0004777 dre-miR-732 CUCAAAGCAGAGAACUCUCGGU
ENSDART00000002583 MI0001953 dre-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENSDART00000002583 MI0004882 xtr-miR-425-5p AAUGACACGAUCACUCCCGUUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932