ABCA4 | GeneID:444852 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 444852 Official Symbol ABCA4
Locus N/A Gene Type protein-coding
Synonyms abcr
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 4
Chromosome N/A
Also Known As ATP-binding cassette, sub-family A member 4; RIM ABC transporter; retinal-specific ATP-binding cassette transporter
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 298

ID Symbol Protein Species
GeneID:24 ABCA4 NP_000341.2 Homo sapiens
GeneID:11304 Abca4 NP_031404.1 Mus musculus
GeneID:171782 abt-2 NP_490949.3 Caenorhabditis elegans
GeneID:281584 ABCA4 NP_776646.1 Bos taurus
GeneID:310836 Abca4 XP_241525.3 Rattus norvegicus
GeneID:424490 ABCA4 XP_422330.2 Gallus gallus
GeneID:444852 ABCA4 NP_001003360.2 Canis lupus familiaris
GeneID:555506 LOC555506 XP_683123.3 Danio rerio
GeneID:745972 ABCA4 XP_001152577.1 Pan troglodytes

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001003360 NP_001003360

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000005367 MI0004731 bta-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSCAFT00000005367 MI0004745 bta-miR-26b UUCAAGUAAUUCAGGAUAGGUU
ENSCAFT00000005367 MI0005545 hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU
ENSCAFT00000005367 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENSCAFT00000005367 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENSCAFT00000005367 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSCAFT00000005367 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSCAFT00000005367 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSCAFT00000005367 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSCAFT00000005367 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSCAFT00000005367 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSCAFT00000005367 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSCAFT00000005367 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSCAFT00000005367 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSCAFT00000005367 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSCAFT00000005367 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000005367 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000005367 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000005367 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSCAFT00000005367 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSCAFT00000005367 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kijas JW, et al. (2004) "Cloning of the canine ABCA4 gene and evaluation in canine cone-rod dystrophies and progressive retinal atrophies." Mol Vis. 10():223-232. PMID:15064680