acly | GeneID:436922 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 436922 Official Symbol acly
Locus N/A Gene Type protein-coding
Synonyms cb722; zgc:92008
Full Name ATP citrate lyase
Description ATP citrate lyase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 854

ID Symbol Protein Species
GeneID:47 ACLY NP_001087.2 Homo sapiens
GeneID:24159 Acly NP_058683.1 Rattus norvegicus
GeneID:36760 ATPCL NP_523755.1 Drosophila melanogaster
GeneID:104112 Acly NP_598798.1 Mus musculus
GeneID:179795 B0365.1 NP_506267.1 Caenorhabditis elegans
GeneID:180485 D1005.1 NP_508280.1 Caenorhabditis elegans
GeneID:395373 ACLY NP_001025711.1 Gallus gallus
GeneID:436922 acly NP_001002649.1 Danio rerio
GeneID:454672 ACLY XP_511495.2 Pan troglodytes
GeneID:511135 ACLY NP_001032534.1 Bos taurus
GeneID:607852 ACLY XP_861266.1 Canis lupus familiaris
GeneID:819845 ACLB-1 NP_187317.1 Arabidopsis thaliana
GeneID:835006 ACLB-2 NP_199757.1 Arabidopsis thaliana
GeneID:1279572 AgaP_AGAP010156 XP_319323.2 Anopheles gambiae
GeneID:2539879 SPBC1703.07 NP_596202.1 Schizosaccharomyces pombe
GeneID:2684892 MGG_06719 XP_370222.1 Magnaporthe grisea
GeneID:2708922 NCU06785.1 XP_327071.1 Neurospora crassa
GeneID:4325777 Os01g0300200 NP_001042817.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005524 Function ATP binding
GO:0003878 Function ATP citrate synthase activity
GO:0005488 Function binding
GO:0003824 Function catalytic activity
GO:0016829 Function lyase activity
GO:0004775 Function succinate-CoA ligase (ADP-forming) activity
GO:0046912 Function transferase activity, transferring acyl groups, acyl groups converted into alkyl on transfer
GO:0044262 Process cellular carbohydrate metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001002649 NP_001002649

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000044162 MI0001950 dre-miR-30e* CUUUCAGUCGGAUGUUUGCAGC
ENSDART00000044162 MI0002077 dre-miR-455 UAUGUGCCCUUGGACUACAUCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932