acaa1 | GeneID:431754 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 431754 Official Symbol acaa1
Locus N/A Gene Type protein-coding
Synonyms zgc:92385
Full Name acetyl-Coenzyme A acyltransferase 1
Description acetyl-Coenzyme A acyltransferase 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 91131

ID Symbol Protein Species
GeneID:235674 Acaa1b NP_666342.1 Mus musculus
GeneID:431754 acaa1 NP_001002207.1 Danio rerio
GeneID:854646 POT1 NP_012106.1 Saccharomyces cerevisiae
GeneID:2680520 MGG_09512 XP_364667.2 Magnaporthe grisea
GeneID:2705979 NCU04796.1 XP_324153.1 Neurospora crassa
GeneID:2895079 KLLA0F10879g XP_455575.1 Kluyveromyces lactis
GeneID:4348804 Os10g0457600 NP_001064764.1 Oryza sativa
GeneID:4622112 AGOS_AFR302W NP_985849.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0008415 Function acyltransferase activity
GO:0003824 Function catalytic activity
GO:0016740 Function transferase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001002207 NP_001002207

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000007997 MI0001966 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000007997 MI0001967 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000007997 MI0001968 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000007997 MI0001969 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000007997 MI0001970 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000007997 MI0001971 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000007997 MI0003692 dre-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSDART00000007997 MI0003364 dre-miR-135b UAUGGCUUUUUAUUCCUAUCUG
ENSDART00000007997 MI0001996 dre-miR-135c UAUGGCUUUCUAUUCCUAUGUG
ENSDART00000007997 MI0001997 dre-miR-135c UAUGGCUUUCUAUUCCUAUGUG
ENSDART00000007997 MI0001998 dre-miR-135c UAUGGCUUUCUAUUCCUAUGUG
ENSDART00000007997 MI0002040 dre-miR-202 AGAGGCAUAGGGCAUGGGAAAA
ENSDART00000007997 MI0001922 dre-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSDART00000007997 MI0004768 dre-miR-724 UUAAAGGGAAUUUGCGACUGUU
ENSDART00000007997 MI0001951 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000007997 MI0001952 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000007997 MI0001953 dre-miR-92b UAUUGCACUCGUCCCGGCCUCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Rekha RD, et al. (2008) "Thioacetamide accelerates steatohepatitis, cirrhosis and HCC by expressing HCV core protein in transgenic zebrafish Danio rerio." Toxicology. 243(1-2):11-22. PMID:17997003
  2. [ + ] Amali AA, et al. (2006) "Thioacetamide induced liver damage in zebrafish embryo as a disease model for steatohepatitis." J Biomed Sci. 13(2):225-232. PMID:16456712
  3. [ + ] Cheng W, et al. (2006) "HNF factors form a network to regulate liver-enriched genes in zebrafish." Dev Biol. 294(2):482-496. PMID:16631158
  4. [ + ] Lo J, et al. (2003) "15000 unique zebrafish EST clusters and their future use in microarray for profiling gene expression patterns during embryogenesis." Genome Res. 13(3):455-466. PMID:12618376
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932