acaa1 | GeneID:431754 | Danio rerio
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 431754 | Official Symbol | acaa1 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | zgc:92385 | ||
| Full Name | acetyl-Coenzyme A acyltransferase 1 | ||
| Description | acetyl-Coenzyme A acyltransferase 1 | ||
| Chromosome | N/A | ||
| Also Known As | |||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 91131
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:235674 | Acaa1b | NP_666342.1 | Mus musculus |
| GeneID:431754 | acaa1 | NP_001002207.1 | Danio rerio |
| GeneID:854646 | POT1 | NP_012106.1 | Saccharomyces cerevisiae |
| GeneID:2680520 | MGG_09512 | XP_364667.2 | Magnaporthe grisea |
| GeneID:2705979 | NCU04796.1 | XP_324153.1 | Neurospora crassa |
| GeneID:2895079 | KLLA0F10879g | XP_455575.1 | Kluyveromyces lactis |
| GeneID:4348804 | Os10g0457600 | NP_001064764.1 | Oryza sativa |
| GeneID:4622112 | AGOS_AFR302W | NP_985849.1 | Eremothecium gossypii |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005575 | Component | cellular_component |
| GO:0008415 | Function | acyltransferase activity |
| GO:0003824 | Function | catalytic activity |
| GO:0016740 | Function | transferase activity |
| GO:0008152 | Process | metabolic process |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001002207 | NP_001002207 | |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSDART00000007997 | MI0001966 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000007997 | MI0001967 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000007997 | MI0001968 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000007997 | MI0001969 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000007997 | MI0001970 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000007997 | MI0001971 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000007997 | MI0003692 | dre-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| ENSDART00000007997 | MI0003364 | dre-miR-135b | UAUGGCUUUUUAUUCCUAUCUG |
| ENSDART00000007997 | MI0001996 | dre-miR-135c | UAUGGCUUUCUAUUCCUAUGUG |
| ENSDART00000007997 | MI0001997 | dre-miR-135c | UAUGGCUUUCUAUUCCUAUGUG |
| ENSDART00000007997 | MI0001998 | dre-miR-135c | UAUGGCUUUCUAUUCCUAUGUG |
| ENSDART00000007997 | MI0002040 | dre-miR-202 | AGAGGCAUAGGGCAUGGGAAAA |
| ENSDART00000007997 | MI0001922 | dre-miR-25 | CAUUGCACUUGUCUCGGUCUGA |
| ENSDART00000007997 | MI0004768 | dre-miR-724 | UUAAAGGGAAUUUGCGACUGUU |
| ENSDART00000007997 | MI0001951 | dre-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENSDART00000007997 | MI0001952 | dre-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENSDART00000007997 | MI0001953 | dre-miR-92b | UAUUGCACUCGUCCCGGCCUCC |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Rekha RD, et al. (2008) "Thioacetamide accelerates steatohepatitis, cirrhosis and HCC by expressing HCV core protein in transgenic zebrafish Danio rerio." Toxicology. 243(1-2):11-22. PMID:17997003 - [
] Amali AA, et al. (2006) "Thioacetamide induced liver damage in zebrafish embryo as a disease model for steatohepatitis." J Biomed Sci. 13(2):225-232. PMID:16456712 - [
] Cheng W, et al. (2006) "HNF factors form a network to regulate liver-enriched genes in zebrafish." Dev Biol. 294(2):482-496. PMID:16631158 - [
] Lo J, et al. (2003) "15000 unique zebrafish EST clusters and their future use in microarray for profiling gene expression patterns during embryogenesis." Genome Res. 13(3):455-466. PMID:12618376 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
Hepatocellular carcinoma (HCC) is one of the common cancers worldwide, caused by Hepatitis C virus (HCV) and hepatotoxins. Here we report the development of HCC in wild type as well as HCV core protein (HCP)-transgenic zebrafish upon treatment with a hepatotoxin, thioacetamide (TAA). Two-fold accelerated HCC development could be achieved in the TAA-treated transgenic fish, that is, the progression of the disease in TAA-treated wild type zebrafish developed HCC in 12 weeks whereas that of HCP-transgenic zebrafish shortened the HCC progression to 6 weeks. Histopathological observation showed the specific pathological features of HCC. The HCC progression was confirmed through RT-PCR that revealed an up and down regulation of different marker genes at various stages of HCC progression such as, steatohepatitis, fibrosis and HCC. Moreover, HCV core protein expressed in the HCP-transgenic zebrafish and TAA synergistically accelerate the HCC development. It must be mentioned that, this is the first report revealing HCV core protein along with TAA to induce HCC in zebrafish, particularly, in a short period of time comparing to mice model. As zebrafish has already been considered as a good human disease model and in this context, this HCC-zebrafish model may serve as a powerful preclinical platform to study the molecular events in hepatocarcinogenesis, therapeutic strategies and for evaluating chemoprevention strategies in HCC.
Steatohepatitis has recently been increasing as a cofactor influencing the progression of fibrosis, cirrhosis, adenoma and carcinoma in liver; however, the mechanisms by which it contributes to liver injury remain uncertain. We induced steatohepatitis in zebrafish embryos using thioacetamide (TAA). TUNEL assay revealed significant increasing of apoptosis in liver after 5 days post fertilization and the increasing of apoptosis was observed to be associated with the up-regulation of apoptotic genes such as, bad, bax, P-38a, caspase-3 and 8, and JNK-1. Histological sections by oil red O stain showed the accumulation of fatty droplets which causes the pushing of the nucleus towards one side. Up-regulation of steatosis markers such as, ACC, adiponectin, PTL, CEBP- alpha and beta, SREBP-1 was also observed. Furthermore, the elevation of glutathione peroxidase in TAA treated embryos indicated that TAA induces lipid peroxidation which leads to causes liver damage. Zebrafish has already been considered as a good human disease model and in this context; TAA-treated zebrafish may serve as a good animal model to study the molecular pathogenesis of steatohepatitis. Moreover, non-availability of specific drugs to prevent steatohepatitis, this animal model may serve as a powerful preclinical platform to study the therapeutic strategies and for evaluating chemoprevention strategies for this disease.
Defects in some of liver-enriched genes in mammals will cause liver- and/or blood-related diseases. However, due to the fact that embryogenesis happens intrauterinally in the mammals, the function of these liver-enriched genes during liver organogenesis is poorly studied. We report here the identification of 129 genuine liver-enriched genes in adult zebrafish and show that, through in situ hybridization, 69 of these genes are also enriched in the embryonic liver. External embryogenesis coupled with the well-established morpholino-mediated gene knock-down technique in zebrafish offers us a unique opportunity to study if this group of genes plays any role during liver organogenesis in the future. As an example, preliminary study using morpholino-mediated gene knock-down method revealed that a novel liver-enriched gene leg1 is crucial for the liver expansion growth. We also report the analysis of promoter regions of 51 liver-enriched genes by searching putative binding sites for Hnf1, Hnf3, Hnf4 and Hnf6, four key transcription factors enriched in the liver. We found that promoter regions of majority of liver-enriched genes contain putative binding sites for more than one HNF factors, suggesting that most of liver-enriched genes are likely co-regulated by different combination of HNF factors. This observation supports the hypothesis that these four liver-enriched transcription factors form a network in controlling the expression of liver-specific or -enriched genes in the liver.
A total of 15590 unique zebrafish EST clusters from two cDNA libraries have been identified. Most significantly, only 22% (3437) of the 15590 unique clusters matched 2805 (of 15200) clusters in the Danio rerio UniGene database, indicating that our EST set is complementary to the existing ESTs in the public database and will be invaluable in assisting the annotation of genes based on the upcoming zebrafish genome sequence. Blast search showed that 7824 of our unique clusters matched 6710 known or predicted proteins in the nonredundant database. A cDNA microarray representing approximately 3100 unique zebrafish cDNA clusters has been generated and used to profile the gene expression patterns across six different embryonic stages (cleavage, blastula, gastrula, segmentation, pharyngula, and hatching). Analysis of expression data using K-means clustering revealed that genes coding for muscle-specific proteins displayed similar expression patterns, confirming that the coordinate gene expression is important for myogenesis. Our results demonstrate that the combination of microarray technology with the zebrafish model system can provide useful information on how genes are coordinated in a genetic network to control zebrafish embryogenesis and can help to identify novel genes that are important for organogenesis.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).