ABRA | GeneID:430953 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 430953 Official Symbol ABRA
Locus N/A Gene Type protein-coding
Synonyms
Full Name actin-binding Rho activating protein
Description actin-binding Rho activating protein
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 34713

ID Symbol Protein Species
GeneID:137735 ABRA NP_631905.1 Homo sapiens
GeneID:172722 F36F2.1 NP_492426.1 Caenorhabditis elegans
GeneID:223513 Abra NP_780665.1 Mus musculus
GeneID:286965 Abra NP_787038.1 Rattus norvegicus
GeneID:430953 ABRA XP_428503.1 Gallus gallus
GeneID:445477 zgc:92005 NP_001003986.1 Danio rerio
GeneID:472838 ABRA XP_528210.1 Pan troglodytes
GeneID:481999 ABRA XP_539120.2 Canis lupus familiaris
GeneID:539379 ABRA XP_586763.1 Bos taurus
GeneID:1281661 AgaP_AGAP001515 XP_321607.2 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_428503 XP_428503

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000025913 MI0001281 gga-miR-142-3p UGUAGUGUUUCCUACUUUAUGG
ENSGALT00000025913 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENSGALT00000025913 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSGALT00000025913 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSGALT00000025913 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSGALT00000025913 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSGALT00000025913 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSGALT00000025913 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSGALT00000025913 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENSGALT00000025913 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENSGALT00000025913 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENSGALT00000025913 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSGALT00000025913 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENSGALT00000025913 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSGALT00000025913 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSGALT00000025913 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSGALT00000025913 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_428503  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene