FOXO4 | GeneID:4303 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 4303 Official Symbol FOXO4
Locus N/A Gene Type protein-coding
Synonyms AFX; AFX1; MGC120490; MLLT7
Full Name forkhead box O4
Description forkhead box O4
Chromosome Xq13.1
Also Known As OTTHUMP00000023496; myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog); translocated to, 7; myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4342

ID Symbol Protein Species
GeneID:4303 FOXO4 NP_005929.2 Homo sapiens
GeneID:54601 Foxo4 NP_061259.1 Mus musculus
GeneID:302415 Foxo4 XP_228556.4 Rattus norvegicus
GeneID:428703 FOXO4 XP_426261.2 Gallus gallus
GeneID:473659 FOXO4 XP_001135016.1 Pan troglodytes
GeneID:491946 FOXO4 XP_549066.2 Canis lupus familiaris
GeneID:563719 LOC563719 XP_692168.2 Danio rerio
GeneID:618793 FOXO4 XP_876209.2 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab12075 FOXO4 antibody (ab12075); Rabbit polyclonal to FOXO4
2 abcam ab47396 FOXO4 antibody (ab47396); Rabbit polyclonal to FOXO4
3 abcam ab63254 FOXO4 antibody (ab63254); Rabbit polyclonal to FOXO4
4 abcam ab60271 FOXO4 antibody (ab60271); Goat polyclonal to FOXO4
5 abcam ab60086 FOXO4 antibody (ab60086); Rabbit polyclonal to FOXO4
6 abcam ab58517 FOXO1 + FOXO3 + FOXO4 (phospho T24 + T32) antibody (ab58517); Rabbit polyclonal to FOXO1 + FOXO3 + FOXO4 (phospho T24 + T32)
7 abcam ab58518 FOXO1 + FOXO3 + FOXO4 antibody (ab58518); Rabbit polyclonal to FOXO1 + FOXO3 + FOXO4
8 abcam ab49598 FOXO4 antibody [AF3.10] - Carboxyterminal end (ab49598); Mouse monoclonal [AF3.10] to FOXO4 - Carboxyterminal end
9 abcam ab47278 FOXO4 (phospho S197) antibody (ab47278); Rabbit polyclonal to FOXO4 (phospho S197)
10 abcam ab24505 FOXO4 antibody (ab24505); Rabbit polyclonal to FOXO4
11 abcam ab2560 FOXO4 (phospho S193) antibody (ab2560); Rabbit polyclonal to FOXO4 (phospho S193)
12 abgent AP6193a MLLT7 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
13 acris AP02424PU-S FOXO4 / AFX1 / MLLT7 pSer197; antibody Ab
14 acris AP16621PU-N FOXO4 / AFX1 / MLLT7; antibody Ab
15 acris AP02424PU-N FOXO4 / AFX1 / MLLT7 pSer197; antibody Ab
16 acris AP00150PU-N FOXO4 / AFX1 / MLLT7; antibody Ab
17 acris AP00084PU-N FOXO4 / AFX1 / MLLT7 pSer193; antibody Ab
18 acris AP02683PU-N FOXO4 / AFX1 / MLLT7; antibody Ab
19 acris AP07944PU-N FOXO4 / AFX1 / MLLT7; antibody Ab
20 acris AP02683PU-S FOXO4 / AFX1 / MLLT7; antibody Ab
21 acris AP13166PU-N FOXO4 / AFX1 / MLLT7 (N-term); antibody Ab
22 acris AP07416PU-N FOXO4 / AFX1 / MLLT7 pSer197; antibody Ab
23 scbt FOXO4 FOXO4 Antibody / FOXO4 Antibodies;
24 sigma A5854 Monoclonal Anti-AFX (FOXO4) antibody produced in mouse ;
25 sigma A8975 Anti-AFX antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FOXO4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FOXO4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0005634 Component nucleus
GO:0019899 Function enzyme binding
GO:0043565 Function sequence-specific DNA binding
GO:0016563 Function transcription activator activity
GO:0003700 Function transcription factor activity
GO:0008134 Function transcription factor binding
GO:0007049 Process cell cycle
GO:0007050 Process cell cycle arrest
GO:0030154 Process cell differentiation
GO:0000080 Process G1 phase of mitotic cell cycle
GO:0008286 Process insulin receptor signaling pathway
GO:0007095 Process mitotic cell cycle G2/M transition DNA damage checkpoint
GO:0007275 Process multicellular organismal development
GO:0007517 Process muscle organ development
GO:0016525 Process negative regulation of angiogenesis
GO:0008285 Process negative regulation of cell proliferation
GO:0051151 Process negative regulation of smooth muscle cell differentiation
GO:0045941 Process positive regulation of transcription
GO:0006355 Process regulation of transcription, DNA-dependent
GO:0006366 Process transcription from RNA polymerase II promoter

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005938  UCSC Browser NP_005929

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000374259 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENST00000374259 MI0000487 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU
ENST00000374259 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000374259 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000374259 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENST00000374259 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000374259 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000374259 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENST00000374259 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENST00000374259 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000374259 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000374259 MI0003600 hsa-miR-550* UGUCUUACUCCCUCAGGCACAU
ENST00000374259 MI0003601 hsa-miR-550* UGUCUUACUCCCUCAGGCACAU
ENST00000374259 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENST00000374259 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENST00000374259 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENST00000374259 MI0003632 hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU
ENST00000374259 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000374259 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENST00000374259 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of FOXO4 mRNA
17562736
Copper
  • Copper results in increased phosphorylation of FOXO4 protein
  • wortmannin inhibits the reaction [Copper results in increased phosphorylation of FOXO4 protein]
16973122
Copper Sulfate
  • Copper Sulfate results in increased phosphorylation of FOXO4 protein
  • wortmannin inhibits the reaction [Copper Sulfate results in increased phosphorylation of FOXO4 protein]
16973122
Niacinamide
  • Niacinamide inhibits the reaction [SIRT1 protein results in increased activity of FOXO4 protein]
  • Niacinamide results in decreased activity of FOXO4 protein
16012755
resveratrol
  • resveratrol inhibits the reaction [INS protein results in increased phosphorylation of FOXO4 protein]
17550345
resveratrol
  • [resveratrol results in increased activity of SIRT1 protein] promotes the reaction [SIRT1 protein binds to and results in decreased acetylation of and results in increased activity of FOXO4 protein]
  • resveratrol promotes the reaction [SIRT1 protein results in increased activity of FOXO4 protein]
  • resveratrol results in increased activity of FOXO4 protein
16012755
wortmannin
  • wortmannin inhibits the reaction [Copper Sulfate results in increased phosphorylation of FOXO4 protein]
  • wortmannin inhibits the reaction [Copper results in increased phosphorylation of FOXO4 protein]
  • wortmannin inhibits the reaction [Zinc Sulfate results in increased phosphorylation of FOXO4 protein]
  • wortmannin inhibits the reaction [Zinc results in increased phosphorylation of FOXO4 protein]
16973122
Zinc
  • Zinc results in increased phosphorylation of FOXO4 protein
  • wortmannin inhibits the reaction [Zinc results in increased phosphorylation of FOXO4 protein]
16973122
Zinc Sulfate
  • Zinc Sulfate results in increased phosphorylation of FOXO4 protein
  • wortmannin inhibits the reaction [Zinc Sulfate results in increased phosphorylation of FOXO4 protein]
16973122

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatolenticular Degeneration inferred via Zinc Sulfate 17063115
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16580781, 16325427, 16410023
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16700911, 16517595, 16606632
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 16393696, 17534123
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17935668, 17049120, 16490592, 16267019, 17164350
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16317513, 17125593, 17015251, 16456233, 16525036
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 16731767, 17718901, 17636462, 17804756, 15767336
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 15827377, 16317513, 16314181
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Pemphigoid, Bullous inferred via Niacinamide 11026799
Alzheimer Disease inferred via Copper 17119284, 16866297, 16886094, 16962711, 16410023, 16325427
Amyotrophic Lateral Sclerosis inferred via Copper 10694572
Anemia, Iron-Deficiency inferred via Copper 16614410
Brain Neoplasms inferred via Copper 17079463
Breast Neoplasms inferred via Copper 15986119, 17079463
Cardiomegaly inferred via Copper 17327471
Hepatitis, Chronic inferred via Copper 17338147
Hepatolenticular Degeneration inferred via Copper 17109627, 16607473, 17276780, 17182432
Kidney Failure, Chronic inferred via Copper 16518626
Learning Disorders inferred via Copper 17134702
Menkes Kinky Hair Syndrome inferred via Copper 17109627, 17268249
Neovascularization, Pathologic inferred via Copper 17308104
Prostatic Neoplasms inferred via Copper 17079463, 17308104
Schizophrenia inferred via Copper 16842975
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 17562736, 16177239, 15968718, 16227642, 14986274
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Essaghir A, et al. (2009) "The transcription of FOXO genes is stimulated by FOXO3 and repressed by growth factors." J Biol Chem. 284(16):10334-10342. PMID:19244250
  2. [ + ] Pisarska MD, et al. (2009) "Expression of forkhead transcription factors in human granulosa cells." Fertil Steril. 91(4 Suppl):1392-1394. PMID:18692812
  3. [ + ] Brenkman AB, et al. (2008) "The peptidyl-isomerase Pin1 regulates p27kip1 expression through inhibition of Forkhead box O tumor suppressors." Cancer Res. 68(18):7597-7605. PMID:18794148
  4. [ + ] Brenkman AB, et al. (2008) "Mdm2 induces mono-ubiquitination of FOXO4." PLoS ONE. 3(7):e2819. PMID:18665269
  5. [ + ] Lee EJ, et al. (2008) "Splice variants of the forkhead box protein AFX exhibit dominant negative activity and inhibit AFXalpha-mediated tumor cell apoptosis." PLoS ONE. 3(7):e2743. PMID:18648506
  6. [ + ] Boura E, et al. (2007) "Both the N-terminal loop and wing W2 of the forkhead domain of transcription factor Foxo4 are important for DNA binding." J Biol Chem. 282(11):8265-8275. PMID:17244620
  7. [ + ] Kim JR, et al. (2006) "Polymorphisms in FOXO gene family and association analysis with BMI." Obesity (Silver Spring). 14(2):188-193. PMID:16571842
  8. [ + ] He J, et al. (2005) "[Detection of fusion genes resulting from chromosome abnormalities in childhood acute lymphoblastic leukemia]" Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 22(5):551-553. PMID:16215946
  9. [ + ] Obsilova V, et al. (2005) "14-3-3 Protein interacts with nuclear localization sequence of forkhead transcription factor FoxO4." Biochemistry. 44(34):11608-11617. PMID:16114898
  10. [ + ] Liu ZP, et al. (2005) "Phenotypic modulation of smooth muscle cells through interaction of Foxo4 and myocardin." Dev Cell. 9(2):261-270. PMID:16054032
  11. [ + ] Essers MA, et al. (2005) "Functional interaction between beta-catenin and FOXO in oxidative stress signaling." Science. 308(5725):1181-1184. PMID:15905404
  12. [ + ] Urbich C, et al. (2005) "FOXO-dependent expression of the proapoptotic protein Bim: pivotal role for apoptosis signaling in endothelial progenitor cells." FASEB J. 19(8):974-976. PMID:15824087
  13. [ + ] Kuiperij HB, et al. (2005) "Activation of FoxO transcription factors contributes to the antiproliferative effect of cAMP." Oncogene. 24(12):2087-2095. PMID:15688004
  14. [ + ] Yang H, et al. (2005) "Constitutively active FOXO4 inhibits Akt activity, regulates p27 Kip1 stability, and suppresses HER2-mediated tumorigenicity." Oncogene. 24(11):1924-1935. PMID:15688030
  15. [ + ] Matsuzaki H, et al. (2005) "Regulation of intracellular localization and transcriptional activity of FOXO4 by protein kinase B through phosphorylation at the motif sites conserved among the FOXO family." J Biochem. 138(4):485-491. PMID:16272144
  16. [ + ] Seoane J, et al. (2004) "Integration of Smad and forkhead pathways in the control of neuroepithelial and glioblastoma cell proliferation." Cell. 117(2):211-223. PMID:15084259
  17. [ + ] Essers MA, et al. (2004) "FOXO transcription factor activation by oxidative stress mediated by the small GTPase Ral and JNK." EMBO J. 23(24):4802-4812. PMID:15538382
  18. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  19. [ + ] van der Horst A, et al. (2004) "FOXO4 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2(SIRT1)." J Biol Chem. 279(28):28873-28879. PMID:15126506
  20. [ + ] Suzuki Y, et al. (2004) "Sequence comparison of human and mouse genes reveals a homologous block structure in the promoter regions." Genome Res. 14(9):1711-1718. PMID:15342556
  21. [ + ] Obsil T, et al. (2003) "Two 14-3-3 binding motifs are required for stable association of Forkhead transcription factor FOXO4 with 14-3-3 proteins and inhibition of DNA binding." Biochemistry. 42(51):15264-15272. PMID:14690436
  22. [ + ] Tang TT, et al. (2003) "The forkhead transcription factor FOXO4 induces the down-regulation of hypoxia-inducible factor 1 alpha by a von Hippel-Lindau protein-independent mechanism." J Biol Chem. 278(32):30125-30135. PMID:12761217
  23. [ + ] Crossley LJ, et al. (2003) "Neutrophil activation by fMLP regulates FOXO (forkhead) transcription factors by multiple pathways, one of which includes the binding of FOXO to the survival factor Mcl-1." J Leukoc Biol. 74(4):583-592. PMID:12960271
  24. [ + ] Fukuoka M, et al. (2003) "Negative regulation of forkhead transcription factor AFX (Foxo4) by CBP-induced acetylation." Int J Mol Med. 12(4):503-508. PMID:12964026
  25. [ + ] Tang TT, et al. (2002) "The forkhead transcription factor AFX activates apoptosis by induction of the BCL-6 transcriptional repressor." J Biol Chem. 277(16):14255-14265. PMID:11777915
  26. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  27. [ + ] So CW, et al. (2002) "MLL-AFX requires the transcriptional effector domains of AFX to transform myeloid progenitors and transdominantly interfere with forkhead protein function." Mol Cell Biol. 22(18):6542-6552. PMID:12192052
  28. [ + ] Kops GJ, et al. (2002) "Control of cell cycle exit and entry by protein kinase B-regulated forkhead transcription factors." Mol Cell Biol. 22(7):2025-2036. PMID:11884591
  29. [ + ] Yang Z, et al. (2002) "An mRNA splice variant of the AFX gene with altered transcriptional activity." J Biol Chem. 277(10):8068-8075. PMID:11779849
  30. [ + ] Weigelt J, et al. (2001) "Solution structure of the DNA binding domain of the human forkhead transcription factor AFX (FOXO4)." Biochemistry. 40(20):5861-5869. PMID:11352721
  31. [ + ] De Ruiter ND, et al. (2001) "Regulation of the Forkhead transcription factor AFX by Ral-dependent phosphorylation of threonines 447 and 451." Mol Cell Biol. 21(23):8225-8235. PMID:11689711
  32. [ + ] Schuur ER, et al. (2001) "Ligand-dependent interaction of estrogen receptor-alpha with members of the forkhead transcription factor family." J Biol Chem. 276(36):33554-33560. PMID:11435445
  33. [ + ] Brownawell AM, et al. (2001) "Inhibition of nuclear import by protein kinase B (Akt) regulates the subcellular distribution and activity of the forkhead transcription factor AFX." Mol Cell Biol. 21(10):3534-3546. PMID:11313479
  34. [ + ] Furuyama T, et al. (2000) "Identification of the differential distribution patterns of mRNAs and consensus binding sequences for mouse DAF-16 homologues." Biochem J. 349(Pt 2):629-634. PMID:10880363
  35. [ + ] Nasrin N, et al. (2000) "DAF-16 recruits the CREB-binding protein coactivator complex to the insulin-like growth factor binding protein 1 promoter in HepG2 cells." Proc Natl Acad Sci U S A. 97(19):10412-10417. PMID:10973497
  36. [ + ] Weigelt J, et al. (2000) "1H, 13C and 15N resonance assignments of the DNA binding domain of the human forkhead transcription factor AFX." J Biomol NMR. 17(2):181-182. PMID:10921784
  37. [ + ] Medema RH, et al. (2000) "AFX-like Forkhead transcription factors mediate cell-cycle regulation by Ras and PKB through p27kip1." Nature. 404(6779):782-787. PMID:10783894
  38. [ + ] Takaishi H, et al. (1999) "Regulation of nuclear translocation of forkhead transcription factor AFX by protein kinase B." Proc Natl Acad Sci U S A. 96(21):11836-11841. PMID:10518537
  39. [ + ] Kops GJ, et al. (1999) "Direct control of the Forkhead transcription factor AFX by protein kinase B." Nature. 398(6728):630-634. PMID:10217147
  40. [ + ] Borkhardt A, et al. (1997) "Cloning and characterization of AFX, the gene that fuses to MLL in acute leukemias with a t(X;11)(q13;q23)." Oncogene. 14(2):195-202. PMID:9010221
  41. [ + ] Peters U, et al. (1997) "AFX1 and p54nrb: fine mapping, genomic structure, and exclusion as candidate genes of X-linked dystonia parkinsonism." Hum Genet. 100(5-6):569-572. PMID:9341872
  42. [ + ] Parry P, et al. (1994) "Cloning and characterization of the t(X;11) breakpoint from a leukemic cell line identify a new member of the forkhead gene family." Genes Chromosomes Cancer. 11(2):79-84. PMID:7529552