ACHE | GeneID:43 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 43 Official Symbol ACHE
Locus N/A Gene Type protein-coding
Synonyms ARACHE; N-ACHE; YT
Full Name acetylcholinesterase (Yt blood group)
Description acetylcholinesterase (Yt blood group)
Chromosome 7q22
Also Known As acetylcholinesterase; apoptosis-related acetylcholinesterase
Summary Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 543

ID Symbol Protein Species
GeneID:43 ACHE NP_000656.1 Homo sapiens
GeneID:11423 Ache NP_033729.1 Mus musculus
GeneID:114549 ache NP_571921.1 Danio rerio
GeneID:181706 ace-1 NP_510660.1 Caenorhabditis elegans
GeneID:489828 ACHE XP_546946.2 Canis lupus familiaris
GeneID:540446 ACHE NP_001069688.1 Bos taurus
GeneID:1281827 ACE1 XP_321792.1 Anopheles gambiae
GeneID:2681253 MGG_02130 XP_365428.1 Magnaporthe grisea

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab35381 Acetylcholinesterase antibody (Alkaline Phosphatase) (ab35381); Sheep polyclonal to Acetylcholinesterase (Alkaline Phosphatase)
2 abcam ab35384 Acetylcholinesterase antibody (ab35384); Sheep polyclonal to Acetylcholinesterase
3 abcam ab23455 Acetylcholinesterase antibody [HYB 111-05] (ab23455); Mouse monoclonal [HYB 111-05] to Acetylcholinesterase
4 abcam ab2803 Acetylcholinesterase antibody [HR2] (ab2803); Mouse monoclonal [HR2] to Acetylcholinesterase
5 abcam ab17774 Acetylcholinesterase antibody [190-01] (ab17774); Mouse monoclonal [190-01] to Acetylcholinesterase
6 abcam ab31276 Acetylcholinesterase antibody (ab31276); Goat polyclonal to Acetylcholinesterase
7 abgent AP7853b ACHE Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP7853a ACHE Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
9 abnova MAB0200 ACHE monoclonal antibody; Mouse monoclonal antibody raised against a native ACHE.
10 abnova H00000043-M02 ACHE monoclonal antibody (M02), clone 2C3; Mouse monoclonal antibody raised against a partial recombinant ACHE.
11 abnova MAB0212 ACHE monoclonal antibody; Mouse monoclonal antibody raised against synthetic peptides of ACHE.
12 acris AP14694PU-N Acetylcholinesterase (C-term); antibody Ab
13 acris AP08301PU-N Acetylcholinesterase (N-term); antibody Ab
14 acris SM5088 Acetylcholinesterase; antibody Ab
15 acris BP206AP Acetylcholinesterase; antibody Ab
16 acris BM366S Acetylcholinesterase; antibody Ab
17 acris AP14693PU-N Acetylcholinesterase (N-term); antibody Ab
18 acris BP206 Acetylcholinesterase; antibody Ab
19 acris AP16331PU-N Acetylcholinesterase (C-term); antibody Ab
20 scbt ACHE ACHE Antibody / ACHE Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACHE Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACHE Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0031225 Component anchored to membrane
GO:0005605 Component basal lamina
GO:0030054 Component cell junction
GO:0005576 Component extracellular region
GO:0005794 Component Golgi apparatus
GO:0005634 Component nucleus
GO:0048471 Component perinuclear region of cytoplasm
GO:0005886 Component plasma membrane
GO:0045202 Component synapse
GO:0042166 Function acetylcholine binding
GO:0003990 Function acetylcholinesterase activity
GO:0001540 Function beta-amyloid binding
GO:0004104 Function cholinesterase activity
GO:0005518 Function collagen binding
GO:0043237 Function laminin-1 binding
GO:0042803 Function protein homodimerization activity
GO:0017171 Function serine hydrolase activity
GO:0001507 Process acetylcholine catabolic process in synaptic cleft
GO:0042982 Process amyloid precursor protein metabolic process
GO:0007155 Process cell adhesion
GO:0008283 Process cell proliferation
GO:0006260 Process DNA replication
GO:0007517 Process muscle organ development
GO:0032223 Process negative regulation of synaptic transmission, cholinergic
GO:0002076 Process osteoblast development
GO:0050714 Process positive regulation of protein secretion
GO:0009611 Process response to wounding
GO:0007416 Process synaptogenesis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000665  UCSC Browser NP_000656
2 NM_015831  UCSC Browser NP_056646

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000241069 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000241069 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000241069 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000241069 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000241069 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000241069 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000241069 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000241069 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000241069 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000241069 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000241069 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENST00000241069 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000241069 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000241069 MI0000082 hsa-miR-25* AGGCGGAGACUUGGGCAAUUG
ENST00000241069 MI0000440 hsa-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENST00000241069 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000241069 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000241069 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000241069 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENST00000241069 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENST00000241069 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENST00000241069 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENST00000241069 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENST00000241069 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENST00000241069 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENST00000241069 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000241069 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENST00000241069 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENST00000241069 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENST00000241069 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENST00000241069 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENST00000241069 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000241069 MI0000094 hsa-miR-92a-2* GGGUGGGGAUUUGUUGCAUUAC
ENST00000241069 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000241069 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENST00000241069 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU
ENST00000302913 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENST00000302913 MI0000788 hsa-miR-380* UGGUUGACCAUAGAACAUGCGC
ENST00000302913 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000302913 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENST00000302913 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000302913 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000302913 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENST00000302913 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
10-(fluoroethoxyphosphinyl)-N-(biotinamidopentyl)decanamide
  • 10-(fluoroethoxyphosphinyl)-N-(biotinamidopentyl)decanamide results in decreased activity of ACHE protein
15525694
3-iodo-2-propynylbutylcarbamate
  • 3-iodo-2-propynylbutylcarbamate results in increased activity of ACHE protein
15261450
Acetylcholine
  • ACHE protein results in increased hydrolysis of Acetylcholine
1909249
Acetylcholine
  • ACHE protein results in increased hydrolysis of Acetylcholine
  • ACHE protein results in increased hydrolysis of Acetylcholine
  • ACHE protein results in increased hydrolysis of Acetylcholine
15811534
Acetylthiocholine
  • ACHE protein results in increased metabolism of Acetylthiocholine
16966160
Acetylthiocholine
  • ACHE protein results in increased metabolism of Acetylthiocholine
  • Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide inhibits the reaction [ACHE protein results in increased metabolism of Acetylthiocholine]
  • Dichlorvos inhibits the reaction [ACHE protein results in increased metabolism of Acetylthiocholine]
  • Physostigmine analog inhibits the reaction [ACHE protein results in increased metabolism of Acetylthiocholine]
  • Tetraisopropylpyrophosphamide does not affect the reaction [ACHE protein results in increased metabolism of Acetylthiocholine]
18433895
Acetylthiocholine
  • ACHE protein results in increased metabolism of Acetylthiocholine
12389909
alachlor
  • alachlor results in increased activity of ACHE protein
16998629
alachlor
  • alachlor results in increased expression of ACHE mRNA
12419858
Albuterol
  • Albuterol promotes the reaction [Physostigmine results in increased secretion of ACHE protein]
17158603
Aldicarb
  • Aldicarb results in decreased activity of ACHE protein
  • Obidoxime Chloride does not affect the reaction [Aldicarb results in decreased activity of ACHE protein]
  • pralidoxime does not affect the reaction [Aldicarb results in decreased activity of ACHE protein]
8134223
Aluminum
  • Aluminum promotes the reaction [Lead results in decreased activity of ACHE protein]
15266904
Ascorbic Acid
  • Ascorbic Acid inhibits the reaction [Chlorodiphenyl (54% Chlorine) results in decreased activity of ACHE protein]
16248992
Aspartame
  • Aspartame metabolite results in decreased activity of ACHE protein
16129618
Aspartame
  • Aspartame metabolite results in decreased activity of ACHE protein
  • Aspartame metabolite results in decreased activity of ACHE protein
17673349, 17580119
Atrazine
  • Atrazine does not affect the activity of ACHE protein
16865602
Atrazine
  • [Chlorpyrifos co-treated with cyanazine co-treated with Atrazine] results in decreased activity of ACHE protein
11878473
Atropine
  • Atropine inhibits the reaction [Organophosphorus Compounds results in decreased activity of ACHE protein]
16293236
azamethiphos
  • azamethiphos results in decreased activity of ACHE protein
17615116
Azinphosmethyl
  • Azinphosmethyl results in decreased activity of ACHE protein
8658539
Azinphosmethyl
  • Azinphosmethyl results in decreased activity of ACHE protein
15041264
bendiocarb
  • bendiocarb results in decreased activity of ACHE protein
1909249
Benomyl
  • Benomyl does not affect the activity of ACHE protein
8658539
Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide
  • Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide inhibits the reaction [ACHE protein results in increased metabolism of Acetylthiocholine]
  • Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide results in decreased activity of ACHE protein
18433895
Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide
  • Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide results in decreased activity of ACHE protein
  • Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide results in decreased activity of ACHE protein
  • Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide results in decreased activity of ACHE protein
15811534
Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide
  • Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide inhibits the reaction [tert-Butylhydroperoxide results in increased secretion of ACHE protein]
16903848
bexarotene
  • bexarotene results in decreased expression of ACHE mRNA
16648578
Butyric Acid
  • Butyric Acid does not affect the activity of ACHE protein
14757314
Cadmium
  • Cadmium promotes the reaction [Carbofuran results in decreased activity of ACHE protein]
16257038
Cadmium
  • Cadmium results in decreased activity of ACHE protein
  • Cadmium results in decreased activity of ACHE protein
16828738
Cadmium Chloride
  • Cadmium Chloride results in decreased activity of ACHE protein
11281253
Carbaryl
  • Carbaryl results in decreased activity of ACHE protein
15041264
Carbaryl
  • Carbaryl results in decreased activity of ACHE protein
17590326
Carbaryl
  • Carbaryl results in decreased activity of ACHE protein
  • Carbaryl results in decreased activity of ACHE protein
11841371
Carbaryl
  • Carbaryl results in decreased activity of ACHE protein
1833318
Carbofuran
  • ACHE protein mutant form results in chemical resistance to Carbofuran
9371089
Carbofuran
  • Cadmium promotes the reaction [Carbofuran results in decreased activity of ACHE protein]
  • Carbofuran results in decreased activity of ACHE protein
16257038
Carbofuran
  • Carbofuran results in decreased activity of ACHE protein
17364237
Carbofuran
  • Carbofuran results in decreased activity of ACHE protein
15261450
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased activity of ACHE protein
16496349
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ACHE mRNA
12832660
chebulinic acid
  • chebulinic acid results in decreased expression of ACHE protein
14769215
Chlorfenvinphos
  • Chlorfenvinphos results in decreased activity of ACHE protein
17615116
Chlorodiphenyl (54% Chlorine)
  • Ascorbic Acid inhibits the reaction [Chlorodiphenyl (54% Chlorine) results in decreased activity of ACHE protein]
  • Chlorodiphenyl (54% Chlorine) results in decreased activity of ACHE protein
16248992
Chlorpyrifos
  • [Chlorpyrifos co-treated with cyanazine co-treated with Atrazine] results in decreased activity of ACHE protein
11878473
Chlorpyrifos
  • Chlorpyrifos results in decreased activity of ACHE protein
16865602
Chlorpyrifos
  • Chlorpyrifos results in decreased activity of ACHE protein
17110060, 15207377, 15342957
Chlorpyrifos
  • Chlorpyrifos results in decreased expression of ACHE protein
  • [Chlorpyrifos co-treated with terbutylazine] results in decreased expression of ACHE protein
16085276
Chlorpyrifos
  • ACHE protein does not affect the response to chemical Chlorpyrifos
8551300
Chlorpyrifos
  • Chlorpyrifos results in decreased activity of ACHE protein
16011852, 15178118
chromium hexavalent ion
  • chromium hexavalent ion results in decreased activity of ACHE protein
16785179
Copper
  • Copper results in decreased activity of ACHE protein
  • Copper results in decreased activity of ACHE protein
16828738
Copper
  • Copper results in decreased activity of ACHE protein
16257038
Copper Sulfate
  • Copper Sulfate results in decreased activity of ACHE protein
16828738
Copper Sulfate
  • Copper Sulfate results in decreased activity of ACHE protein
16023296
cyanazine
  • [Chlorpyrifos co-treated with cyanazine co-treated with Atrazine] results in decreased activity of ACHE protein
11878473
cypermethrin
  • cypermethrin results in decreased activity of ACHE protein
  • cypermethrin results in decreased activity of ACHE protein
2365420
cypermethrin
  • cypermethrin results in increased activity of ACHE protein
7595515
cypermethrin
  • cypermethrin results in decreased activity of ACHE protein
12524023
cypermethrin
  • cypermethrin results in decreased activity of ACHE protein
8385837
cypermethrin
  • cypermethrin does not affect the activity of ACHE protein
12716053
cypermethrin
  • ACHE protein does not affect the response to chemical cypermethrin
11107890
cypermethrin
  • cypermethrin does not affect the activity of ACHE protein
1292170
cypermethrin
  • [cypermethrin co-treated with fenvalerate] results in decreased activity of ACHE protein
  • cypermethrin affects the activity of ACHE protein
10355540
DDT
  • DDT does not affect the activity of ACHE protein
16865602
decamethrin
  • ACHE protein does not affect the response to chemical decamethrin
11107890
decamethrin
  • decamethrin does not affect the activity of ACHE protein
17665685
DEET
  • [Pyridostigmine Bromide co-treated with DEET] results in decreased activity of ACHE protein
11248143
DEET
  • DEET results in increased activity of ACHE protein
  • [DEET co-treated with Permethrin] results in increased activity of ACHE protein
14713564
DEET
  • [Pyridostigmine Bromide co-treated with DEET] results in increased activity of ACHE protein
  • [Pyridostigmine Bromide co-treated with Permethrin co-treated with DEET] results in increased activity of ACHE protein
14751452
DEET
  • [Pyridostigmine Bromide co-treated with Permethrin co-treated with DEET] results in decreased activity of ACHE protein
14751452, 11248143
DEET
  • [DEET co-treated with Permethrin] results in decreased activity of ACHE protein
14713564, 11248143
demeton-S-methyl
  • demeton-S-methyl results in decreased activity of ACHE protein
16766477
Desmodium gangeticum extract
  • Desmodium gangeticum extract results in decreased activity of ACHE protein
16946593
Diazinon
  • Diazinon results in decreased activity of ACHE protein
8658539
Diazinon
  • Diazinon results in decreased activity of ACHE protein
15683842
Diazinon
  • Diazinon results in decreased activity of ACHE protein
17239417
Diazinon
  • Diazinon results in decreased activity of ACHE protein
17615116
dibutylnitrosamine
  • dibutylnitrosamine results in increased activity of ACHE protein
15881669
Dichlorvos
  • Dichlorvos results in decreased activity of ACHE protein
16036766, 10975133
Dichlorvos
  • Memantine does not affect the reaction [Dichlorvos results in decreased activity of ACHE protein]
15033007
Dichlorvos
  • Dichlorvos results in decreased activity of ACHE protein
17722737, 15033007, 17188317
Dichlorvos
  • Dichlorvos binds to and results in decreased activity of ACHE protein
16598855
Dichlorvos
  • Tiapride inhibits the reaction [Dichlorvos results in decreased activity of ACHE protein]
16193528, 16036766
Dichlorvos
  • Dichlorvos results in decreased activity of ACHE protein
  • Dichlorvos results in decreased activity of ACHE protein
  • Dichlorvos results in decreased activity of ACHE protein
15811534
Dichlorvos
  • Dichlorvos results in decreased activity of ACHE protein
16023296
Dichlorvos
  • Dichlorvos results in decreased activity of ACHE protein
17665685
Dichlorvos
  • Dichlorvos inhibits the reaction [ACHE protein results in increased metabolism of Acetylthiocholine]
  • Dichlorvos results in decreased activity of ACHE protein
18433895
Dimethoate
  • Dimethoate results in decreased activity of ACHE protein
16701032, 16112538
Dimethoate
  • Dimethoate results in decreased activity of ACHE protein
15779760
Dimethoate
  • Dimethoate results in decreased activity of ACHE protein
17997881, 15033006, 16112789
Dimethoate
  • pralidoxime inhibits the reaction [Dimethoate results in decreased activity of ACHE protein]
16112538
Dimethoate
  • Dimethoate results in decreased activity of ACHE protein
16257584
Dimethoate
  • Dimethoate results in decreased activity of ACHE protein
16833148
Dimethoate
  • Dimethoate results in decreased activity of ACHE protein
17590326
Dimethoate
  • Dimethoate does not affect the activity of ACHE protein
8658539
dimethoxon
  • ACHE protein mutant form results in chemical resistance to dimethoxon
  • dimethoxon results in decreased activity of ACHE protein
12144698
dimethoxon
  • dimethoxon results in decreased activity of ACHE protein
11985885
Disulfiram
  • Disulfiram results in decreased expression of ACHE protein
3868355
Echothiophate Iodide
  • Echothiophate Iodide results in decreased activity of ACHE protein
1909249
Edrophonium
  • Edrophonium results in decreased activity of ACHE protein
1909249
Endosulfan
  • Endosulfan does not affect the activity of ACHE protein
8157075
Endosulfan
  • [Endosulfan co-treated with Malathion] results in decreased activity of ACHE protein
2380476
Endosulfan
  • Endosulfan results in decreased activity of ACHE protein
12648478
Endosulfan
  • Endosulfan does not affect the activity of ACHE protein
10581123
Endosulfan
  • Endosulfan results in decreased activity of ACHE protein
7900959
Ethylenethiourea
  • Ethylenethiourea results in decreased expression of ACHE protein
3868355
Fenthion
  • Fenthion metabolite results in decreased activity of ACHE protein
17110060
Fenthion
  • Fenthion results in decreased activity of ACHE protein
14976351
fenvalerate
  • [cypermethrin co-treated with fenvalerate] results in decreased activity of ACHE protein
  • fenvalerate affects the activity of ACHE protein
10355540
fenvalerate
  • fenvalerate results in decreased activity of ACHE protein
  • fenvalerate results in increased activity of ACHE protein
8739525
fenvalerate
  • fenvalerate does not affect the activity of ACHE protein
16011852
fenvalerate
  • fenvalerate results in increased activity of ACHE protein
8385837
fenvalerate
  • fenvalerate results in decreased activity of ACHE protein
8385837, 15186033
fenvalerate
  • fenvalerate results in decreased activity of ACHE protein
  • fenvalerate results in decreased activity of ACHE protein
2365420
Folic Acid
  • Folic Acid inhibits the reaction [MTHFR gene polymorphism results in increased activity of ACHE protein]
16375580
Galantamine
  • Galantamine results in decreased activity of ACHE protein
  • [Galantamine results in decreased activity of ACHE protein] which results in chemical resistance to Paraoxon
  • [Galantamine results in decreased activity of ACHE protein] which results in chemical resistance to Sarin
  • [Galantamine results in decreased activity of ACHE protein] which results in chemical resistance to Soman
16914529
HI 6
  • HI 6 binds to and results in decreased activity of ACHE protein
16598855
Homocysteine
  • Homocysteine results in increased activity of ACHE protein
16375580
huperzine A
  • huperzine A results in decreased activity of ACHE protein
16914529, 15956816
Hypochlorous Acid
  • Hypochlorous Acid results in decreased activity of ACHE protein
  • [Hypochlorous Acid co-treated with Sodium Nitrite] results in decreased activity of ACHE protein
12414318
Isoflurophate
  • Isoflurophate results in decreased activity of ACHE protein
1909249
Isoflurophate
  • Isoflurophate results in decreased activity of ACHE protein
17615116
Lead
  • Aluminum promotes the reaction [Lead results in decreased activity of ACHE protein]
  • Lead results in decreased activity of ACHE protein
15266904
Lindane
  • Lindane results in decreased activity of ACHE protein
16257038
malaoxon
  • malaoxon results in decreased activity of ACHE protein
17615116
Malathion
  • ACHE protein does not affect the response to chemical Malathion
11107890
Malathion
  • Malathion results in decreased activity of ACHE protein
15683842
Malathion
  • Malathion results in decreased activity of ACHE protein
17364237
Malathion
  • ACHE protein does not affect the response to chemical Malathion
8551300
Malathion
  • [Malathion co-treated with Permethrin] results in decreased activity of ACHE protein
  • [Malathion co-treated with Permethrin] results in increased activity of ACHE protein
14713564
Malathion
  • Malathion results in decreased activity of ACHE protein
17590326
Malathion
  • [Endosulfan co-treated with Malathion] results in decreased activity of ACHE protein
2380476
mancozeb
  • mancozeb results in increased activity of ACHE protein
15261450
mancozeb
  • mancozeb affects the activity of ACHE protein
10641187
Maneb
  • Maneb results in decreased expression of ACHE protein
3868355
Memantine
  • Memantine does not affect the reaction [Dichlorvos results in decreased activity of ACHE protein]
15033007
Methanol
  • Methanol results in decreased activity of ACHE protein
  • Methanol results in decreased activity of ACHE protein
17673349, 17580119
Methanol
  • Methanol results in decreased activity of ACHE protein
16129618
Methomyl
  • ACHE protein affects the chemical susceptibility to Methomyl
11886776
Methomyl
  • ACHE protein polymorphism results in chemical resistance to Methomyl
2904862
Methomyl
  • ACHE protein polymorphism results in chemical resistance to Methomyl
11332849
Methomyl
  • Methomyl results in decreased activity of ACHE protein
9890446, 9442915
Methomyl
  • ACHE protein does not affect the response to chemical Methomyl
10333576
Methomyl
  • Methomyl results in decreased activity of ACHE protein
  • Obidoxime Chloride does not affect the reaction [Methomyl results in decreased activity of ACHE protein]
  • pralidoxime does not affect the reaction [Methomyl results in decreased activity of ACHE protein]
8134223
Methomyl
  • Methomyl results in decreased activity of ACHE protein
1909249
methylparaoxon
  • methylparaoxon results in decreased activity of ACHE protein
12478623
Methyl Parathion
  • Methyl Parathion results in decreased activity of ACHE protein
16645783, 14514956, 12478623, 14746346, 15591769, 15342957
Methyl Parathion
  • Methyl Parathion results in decreased activity of ACHE protein
15889724
Methyl Parathion
  • ACHE protein affects the chemical susceptibility to Methyl Parathion
11886776
Methyl Parathion
  • Methyl Parathion results in decreased activity of ACHE protein
15147928
Methyl Parathion
  • Methyl Parathion results in decreased activity of ACHE protein
16766477
Metoclopramide
  • Metoclopramide inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
  • Metoclopramide inhibits the reaction [mipafox results in decreased activity of ACHE protein]
16193528
mipafox
  • Metoclopramide inhibits the reaction [mipafox results in decreased activity of ACHE protein]
16193528
mipafox
  • mipafox results in decreased activity of ACHE protein
16766477
Monocrotophos
  • Monocrotophos results in decreased activity of ACHE protein
17590326
N(6)-cyclopentyladenosine
  • N(6)-cyclopentyladenosine does not affect the reaction [VX results in decreased activity of ACHE protein]
  • N(6)-cyclopentyladenosine inhibits the reaction [Sarin results in decreased activity of ACHE protein]
12415428
Neostigmine
  • Neostigmine results in decreased activity of ACHE protein
1909249
Neostigmine
  • Neostigmine results in decreased activity of ACHE protein
15683842
Obidoxime Chloride
  • Obidoxime Chloride metabolite results in decreased activity of ACHE protein
15876422
Obidoxime Chloride
  • Obidoxime Chloride does not affect the reaction [Aldicarb results in decreased activity of ACHE protein]
  • Obidoxime Chloride does not affect the reaction [Methomyl results in decreased activity of ACHE protein]
  • Obidoxime Chloride inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
8134223
O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate
  • O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate results in decreased expression of ACHE protein
  • pralidoxime inhibits the reaction [O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate results in decreased expression of ACHE protein]
16085276
O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate
  • O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate results in decreased activity of ACHE protein
17615116
Organophosphorus Compounds
  • Organophosphorus Compounds results in decreased activity of ACHE protein
17098105
Organophosphorus Compounds
  • Atropine inhibits the reaction [Organophosphorus Compounds results in decreased activity of ACHE protein]
  • Pyridostigmine Bromide inhibits the reaction [Organophosphorus Compounds results in decreased activity of ACHE protein]
16293236
Paraoxon
  • [Galantamine results in decreased activity of ACHE protein] which results in chemical resistance to Paraoxon
16914529
Paraoxon
  • Paraoxon results in decreased activity of ACHE protein
12629810
Paraoxon
  • ACHE protein does not affect the response to chemical Paraoxon
10333576
Paraoxon
  • Metoclopramide inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
  • Ranitidine inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
  • Tiapride inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
16193528
Paraoxon
  • Paraoxon results in decreased activity of ACHE protein
1909249
Paraoxon
  • Paraoxon results in decreased activity of ACHE protein
17158603
Paraoxon
  • ACHE protein mutant form results in chemical resistance to Paraoxon
9371089
Paraoxon
  • Paraoxon results in decreased activity of ACHE protein
15683842
Paraoxon
  • Paraoxon results in decreased activity of ACHE protein
8134223, 15876422, 16766477
Paraoxon
  • Obidoxime Chloride inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
  • pralidoxime inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
8134223
Paraquat
  • Paraquat results in decreased activity of ACHE protein
11281253
Paraquat
  • Paraquat results in decreased activity of ACHE protein
17364237
Parathion
  • Parathion results in decreased activity of ACHE protein
12878415
Parathion
  • Parathion results in decreased activity of ACHE protein
10581123
Parathion
  • Parathion results in decreased activity of ACHE protein
15889724
Parathion
  • Parathion results in decreased activity of ACHE protein
17158603
Parathion
  • Parathion results in decreased activity of ACHE protein
15041264
Parathion
  • Parathion results in decreased activity of ACHE protein
15683842
Parathion
  • Parathion does not affect the expression of ACHE protein
  • Parathion results in decreased activity of ACHE protein
12959529
Parathion
  • Parathion results in decreased activity of ACHE protein
15342957
Permethrin
  • Permethrin results in increased activity of ACHE protein
  • [DEET co-treated with Permethrin] results in decreased activity of ACHE protein
14713564, 11248143
Permethrin
  • [Pyridostigmine Bromide co-treated with Permethrin co-treated with DEET] results in decreased activity of ACHE protein
14751452, 11248143
Permethrin
  • Permethrin results in decreased activity of ACHE protein
7595515
Permethrin
  • [Pyridostigmine Bromide co-treated with Permethrin co-treated with DEET] results in increased activity of ACHE protein
  • [Pyridostigmine Bromide co-treated with Permethrin] results in increased activity of ACHE protein
14751452
Permethrin
  • [DEET co-treated with Permethrin] results in increased activity of ACHE protein
  • [Malathion co-treated with Permethrin] results in decreased activity of ACHE protein
  • [Malathion co-treated with Permethrin] results in increased activity of ACHE protein
14713564
Permethrin
  • [Pyridostigmine Bromide co-treated with Permethrin] results in decreased activity of ACHE protein
11248143
Pesticides
  • Pesticides results in decreased expression of ACHE protein
15922524
Phenobarbital
  • Phenobarbital affects the activity of ACHE protein
12959529
phenthoate
  • phenthoate results in decreased activity of ACHE protein
15683842
Phenytoin
  • Phenytoin results in increased activity of ACHE protein
16946593
Phosphamidon
  • Phosphamidon results in decreased activity of ACHE protein
1833318
Phosphoric Acid Esters
  • Phosphoric Acid Esters results in decreased activity of ACHE protein
16872049
Physostigmine
  • Physostigmine results in decreased activity of ACHE protein
  • Physostigmine results in decreased activity of ACHE protein
  • Physostigmine results in decreased activity of ACHE protein
15811534
Physostigmine
  • Physostigmine analog inhibits the reaction [ACHE protein results in increased metabolism of Acetylthiocholine]
  • Physostigmine analog results in decreased activity of ACHE protein
18433895
Physostigmine
  • Physostigmine results in decreased activity of ACHE protein
15683842
Physostigmine
  • Albuterol promotes the reaction [Physostigmine results in increased secretion of ACHE protein]
  • Physostigmine results in decreased activity of ACHE protein
  • Physostigmine results in increased secretion of ACHE protein
17158603
Piracetam
  • Piracetam results in decreased activity of ACHE protein
16946593
pirimicarb
  • ACHE protein affects the chemical susceptibility to pirimicarb
10333576
pirimiphos methyl
  • pirimiphos methyl results in decreased activity of ACHE protein
8658539
pirimiphos methyl
  • ACHE protein does not affect the response to chemical pirimiphos methyl
8551300
pirimiphos methyl
  • ACHE protein does not affect the response to chemical pirimiphos methyl
11107890
Plant Extracts
  • Plant Extracts results in decreased activity of ACHE protein
17168769
Polychlorinated Biphenyls
  • Polychlorinated Biphenyls results in decreased activity of ACHE protein
17097718
Polychlorinated Biphenyls
  • Polychlorinated Biphenyls results in decreased activity of ACHE protein
17289233
pralidoxime
  • pralidoxime inhibits the reaction [O,O-diethyl O-3,5,6-trichloro-2-pyridyl phosphate results in decreased expression of ACHE protein]
16085276
pralidoxime
  • pralidoxime does not affect the reaction [Aldicarb results in decreased activity of ACHE protein]
  • pralidoxime does not affect the reaction [Methomyl results in decreased activity of ACHE protein]
  • pralidoxime inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
8134223
pralidoxime
  • pralidoxime inhibits the reaction [Dimethoate results in decreased activity of ACHE protein]
16112538
pralidoxime
  • pralidoxime binds to and results in decreased activity of ACHE protein
16598855
Propidium
  • Propidium does not affect the activity of ACHE protein
  • Propidium does not affect the activity of ACHE protein
  • Propidium does not affect the activity of ACHE protein
15811534
Propoxur
  • ACHE protein does not affect the response to chemical Propoxur
8551300
Propoxur
  • Propoxur results in decreased activity of ACHE protein
11129708
Propoxur
  • ACHE protein mutant form results in chemical resistance to Propoxur
9371089
Propoxur
  • ACHE protein affects the chemical susceptibility to Propoxur
10333576
Pyridostigmine Bromide
  • Pyridostigmine Bromide results in decreased activity of ACHE protein
  • [Pyridostigmine Bromide co-treated with DEET] results in decreased activity of ACHE protein
  • [Pyridostigmine Bromide co-treated with Permethrin] results in decreased activity of ACHE protein
11248143
Pyridostigmine Bromide
  • Pyridostigmine Bromide results in decreased activity of ACHE protein
16914529
Pyridostigmine Bromide
  • [Pyridostigmine Bromide co-treated with Permethrin co-treated with DEET] results in decreased activity of ACHE protein
14751452, 11248143
Pyridostigmine Bromide
  • Pyridostigmine Bromide inhibits the reaction [Organophosphorus Compounds results in decreased activity of ACHE protein]
16293236
Pyridostigmine Bromide
  • Pyridostigmine Bromide results in decreased activity of ACHE protein
15683842
Pyridostigmine Bromide
  • [Pyridostigmine Bromide co-treated with DEET] results in increased activity of ACHE protein
  • [Pyridostigmine Bromide co-treated with Permethrin co-treated with DEET] results in increased activity of ACHE protein
  • [Pyridostigmine Bromide co-treated with Permethrin] results in increased activity of ACHE protein
14751452
Ranitidine
  • Ranitidine inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
16193528
Sarin
  • [Galantamine results in decreased activity of ACHE protein] which results in chemical resistance to Sarin
  • Sarin results in decreased activity of ACHE protein
16914529
Sarin
  • Sarin results in decreased activity of ACHE protein
15888665
Sarin
  • N(6)-cyclopentyladenosine inhibits the reaction [Sarin results in decreased activity of ACHE protein]
  • Sarin results in decreased activity of ACHE protein
12415428
Sodium Nitrite
  • [Hypochlorous Acid co-treated with Sodium Nitrite] results in decreased activity of ACHE protein
12414318
Soman
  • [Galantamine results in decreased activity of ACHE protein] which results in chemical resistance to Soman
  • Soman results in decreased activity of ACHE protein
16914529
tabun
  • tabun results in decreased activity of ACHE protein
16914529
tellimagrandin I
  • tellimagrandin I results in decreased activity of ACHE protein
14757314
Temefos
  • ACHE protein does not affect the response to chemical Temefos
8551300
terbutylazine
  • [Chlorpyrifos co-treated with terbutylazine] results in decreased expression of ACHE protein
  • terbutylazine does not affect the expression of ACHE protein
16085276
tert-Butylhydroperoxide
  • Benzenaminium, 4,4'-(3-oxo-1,5-pentanediyl)bis(N,N-dimethyl-N-2-propenyl-), Dibromide inhibits the reaction [tert-Butylhydroperoxide results in increased secretion of ACHE protein]
  • tert-Butylhydroperoxide results in increased expression of ACHE mRNA alternative form
  • tert-Butylhydroperoxide results in increased secretion of ACHE protein
16903848
Tetraisopropylpyrophosphamide
  • Tetraisopropylpyrophosphamide does not affect the activity of ACHE protein
  • Tetraisopropylpyrophosphamide does not affect the reaction [ACHE protein results in increased metabolism of Acetylthiocholine]
18433895
Tiapride
  • Tiapride inhibits the reaction [Dichlorvos results in decreased activity of ACHE protein]
16193528, 16036766
Tiapride
  • Tiapride binds to ACHE protein
  • Tiapride inhibits the reaction [Paraoxon results in decreased activity of ACHE protein]
16193528
Toxaphene
  • Toxaphene results in decreased activity of ACHE protein
8262581
Tretinoin
  • Tretinoin results in increased secretion of ACHE protein
16188934
Trichlorfon
  • Trichlorfon results in decreased activity of ACHE protein
11526466
VX
  • VX results in decreased activity of ACHE protein
16914529
VX
  • N(6)-cyclopentyladenosine does not affect the reaction [VX results in decreased activity of ACHE protein]
  • VX results in decreased activity of ACHE protein
12415428
Zineb
  • Zineb results in decreased expression of ACHE protein
3868355

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Liver Cirrhosis, Experimental marker 16496349
Poisoning marker 17098105
Agricultural Workers' Diseases inferred via Zineb 8807224
Dermatitis, Allergic Contact inferred via Zineb 8807224
Dermatitis, Occupational inferred via Zineb 8807224
Cattle Diseases inferred via Trichlorfon 14651886
Strongyloidiasis inferred via Trichlorfon 14651886
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 12679006, 16935935, 17107899, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 16766008, 16788101, 15748426, 16823087
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Agricultural Workers' Diseases inferred via Toxaphene 16132792
Leukemia, Lymphoid inferred via Toxaphene 16132792
Neoplasms inferred via Toxaphene 8820588
Poisoning inferred via Tiapride 16036766
Poisoning inferred via Soman 16914529
Poisoning inferred via Sarin 16914529
Poisoning inferred via pralidoxime 8134223, 16105446
Dementia inferred via Polychlorinated Biphenyls 16140633
Parkinson Disease inferred via Polychlorinated Biphenyls 16702228
Prostatic Neoplasms inferred via Polychlorinated Biphenyls 15721890
Alzheimer Disease inferred via Plant Extracts 16962711
Brain Ischemia inferred via Plant Extracts 16041641
HIV Infections inferred via Plant Extracts 12878215
Hot Flashes inferred via Plant Extracts 16566672
Hyperhomocysteinemia inferred via Plant Extracts 16484555
Inflammation inferred via Plant Extracts 16366677
Liver Cirrhosis, Experimental inferred via Plant Extracts 15479170
Neurobehavioral Manifestations inferred via Plant Extracts 17168769
Prostatic Neoplasms inferred via Plant Extracts 17804756
Poisoning inferred via Physostigmine 17157343
Seizures inferred via Physostigmine 17157343
Abnormalities, Drug-Induced inferred via Phenytoin 3425630, 10563481
Atherosclerosis inferred via Phenytoin 15136057
Cleft Palate inferred via Phenytoin 2227380, 10789828, 3877104, 6856622, 1687470, 6862529
Congenital Abnormalities inferred via Phenytoin 10627286
Drug Eruptions inferred via Phenytoin 15024534
Epidermolysis Bullosa inferred via Phenytoin 6251365, 1399206
Epilepsies, Partial inferred via Phenytoin 17116037
Epilepsy inferred via Phenytoin 11434505
Fetal Death inferred via Phenytoin 10627286
Gingival Hyperplasia inferred via Phenytoin 9029455
Gingival Overgrowth inferred via Phenytoin 16390469, 14659971
Hyperhomocysteinemia inferred via Phenytoin 10459572
Liver Diseases inferred via Phenytoin 14986274
Myoclonic Epilepsies, Progressive inferred via Phenytoin 17484760
Myotonia Congenita inferred via Phenytoin 1896199
Osteomalacia inferred via Phenytoin 17016548
Pseudolymphoma inferred via Phenytoin 1419762, 8603615, 12752131
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Agricultural Workers' Diseases inferred via Pesticides 17119214
Respiratory Sounds inferred via Pesticides 17119214
Respiratory Tract Diseases inferred via Pesticides 17119214
Dermatitis, Contact inferred via Permethrin 14617103
Insect Bites and Stings inferred via Permethrin 15189238, 12971516, 12749493
Leukemia inferred via Permethrin 12937054
Agricultural Workers' Diseases inferred via Parathion 11874814, 17119214
Breast Neoplasms inferred via Parathion 12762645
Infertility, Male inferred via Parathion 16029889
Respiratory Sounds inferred via Parathion 11874814, 17119214
Respiratory Tract Diseases inferred via Parathion 17119214
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 16140633, 16510128, 11124998, 11445065, 11181820, 15451049
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Atherosclerosis inferred via Paraoxon 16391483
Basal Ganglia Diseases inferred via Organophosphorus Compounds 16804273
Coma inferred via Organophosphorus Compounds 17098105
Hypotension inferred via Organophosphorus Compounds 17098105
Poisoning inferred via Organophosphorus Compounds 17098105
Polyneuropathies inferred via Organophosphorus Compounds 16042503
Respiratory Insufficiency inferred via Organophosphorus Compounds 17098105, 16449848
Poisoning inferred via Obidoxime Chloride 8134223
Poisoning inferred via N(6)-cyclopentyladenosine 16105447
Agricultural Workers' Diseases inferred via Monocrotophos 16487989
Dyspnea inferred via Monocrotophos 16487989
Hepatitis inferred via Monocrotophos 16487989
Urologic Diseases inferred via Monocrotophos 16487989
Poisoning inferred via Methyl Parathion 17603234
Pancreatitis inferred via Methomyl 15767733, 16258382
Poisoning inferred via Methomyl 11800311
Seizures inferred via Methomyl 11218047, 12660363
Poisoning inferred via Memantine 15824473
Abnormalities, Drug-Induced inferred via Maneb 982313
Agricultural Workers' Diseases inferred via Maneb 8807224
Dermatitis, Allergic Contact inferred via Maneb 8807224
Dermatitis, Occupational inferred via Maneb 8807224
Gliosis inferred via Maneb 11124998
Nerve Degeneration inferred via Maneb 15350641, 16893418
Parkinson Disease inferred via Maneb 12911755, 16140633, 11124998, 16510128, 15824117
Abnormalities, Drug-Induced inferred via mancozeb 982313
Agricultural Workers' Diseases inferred via mancozeb 16132792, 8807224, 15864902
Dermatitis, Allergic Contact inferred via mancozeb 8807224
Dermatitis, Occupational inferred via mancozeb 8807224
Leukemia, Lymphoid inferred via mancozeb 16132792
Nerve Degeneration inferred via mancozeb 15350641
Neural Tube Defects inferred via mancozeb 15864902
Pancreatic Neoplasms inferred via mancozeb 16965848, 8603375
Skin Neoplasms inferred via mancozeb 1733566
Agricultural Workers' Diseases inferred via Malathion 11874814, 17119214
Breast Neoplasms inferred via Malathion 12762645
Respiratory Sounds inferred via Malathion 11874814, 17119214
Respiratory Tract Diseases inferred via Malathion 17119214
Agricultural Workers' Diseases inferred via Lindane 12661182
Breast Neoplasms inferred via Lindane 14688026
Neoplasms inferred via Lindane 16818664, 12807735
Prostatic Neoplasms inferred via Lindane 14688026, 12661182
Seizures inferred via Lindane 7539098
Dementia inferred via Lead 16140633
Essential Tremor inferred via Lead 18007985
Infertility, Male inferred via Lead 16780224
Lead Poisoning inferred via Lead 16700817
Learning Disorders inferred via Lead 16384672
Memory Disorders inferred via Lead 17263510, 16384672
Prenatal Exposure Delayed Effects inferred via Lead 16384672
Alzheimer Disease inferred via huperzine A 12586202
Coronary Artery Disease inferred via Homocysteine 16379339
Exfoliation Syndrome inferred via Homocysteine 16504073
Glaucoma inferred via Homocysteine 16504073
Hyperhomocysteinemia inferred via Homocysteine 17369066
Meningomyelocele inferred via Homocysteine 16602021
Myocardial Infarction inferred via Homocysteine 17412321
Parkinson Disease inferred via Homocysteine 16275827
Schizophrenia inferred via Homocysteine 16641680
Alzheimer Disease inferred via Galantamine 16914529
Poisoning inferred via Galantamine 16914529
Adenoma inferred via Folic Acid 16963246
Alzheimer Disease inferred via Folic Acid 17116317
Breast Neoplasms inferred via Folic Acid 16777985
Cardiovascular Diseases inferred via Folic Acid 16755160
Colorectal Neoplasms inferred via Folic Acid 16963246, 16985020, 17087956, 17245555, 17116713
Diabetes Mellitus, Type 2 inferred via Folic Acid 16886840
Endometrial Neoplasms inferred via Folic Acid 17301261
Exfoliation Syndrome inferred via Folic Acid 16504073
Gastritis inferred via Folic Acid 17171786
Glaucoma inferred via Folic Acid 16504073
Heart Defects, Congenital inferred via Folic Acid 17286298, 16524890
HIV Seropositivity inferred via Folic Acid 17209195
Hyperhomocysteinemia inferred via Folic Acid 16397167, 16865747, 16395265, 16755160, 16433478
Liver Diseases inferred via Folic Acid 16877991
Lupus Erythematosus, Systemic inferred via Folic Acid 17718048
Maxillofacial Abnormalities inferred via Folic Acid 16832597
Neural Tube Defects inferred via Folic Acid 17438019
Neutropenia inferred via Folic Acid 16322990
Schizophrenia inferred via Folic Acid 16641680
Spinal Cord Diseases inferred via Folic Acid 16361298
Stomach Neoplasms inferred via Folic Acid 17171786
Stroke inferred via Folic Acid 16517955
Hepatomegaly inferred via fenvalerate 15602828
Neoplasms inferred via fenvalerate 2895627
Cyanosis inferred via Endosulfan 7900959
Dyspnea inferred via Endosulfan 7900959, 3388749
Emphysema inferred via Endosulfan 7900959
Hemorrhage inferred via Endosulfan 7900959
Infertility, Male inferred via Endosulfan 8588293, 9432128
Learning Disorders inferred via Endosulfan 8157075
Seizures inferred via Endosulfan 10698677, 7539098
Alcoholism inferred via Disulfiram 17079463
Neoplasms inferred via Disulfiram 17079463
Agricultural Workers' Diseases inferred via Dichlorvos 17119214, 12661182, 16611668
Basal Ganglia Diseases inferred via Dichlorvos 15303389
Cattle Diseases inferred via Dichlorvos 14651886
Central Nervous System Diseases inferred via Dichlorvos 12670839
Coma inferred via Dichlorvos 15303389
Horse Diseases inferred via Dichlorvos 16402567
Hyperesthesia inferred via Dichlorvos 12563396
Kidney Diseases inferred via Dichlorvos 16798900
Motor Neuron Disease inferred via Dichlorvos 11282359
Nematode Infections inferred via Dichlorvos 16402567
Nerve Degeneration inferred via Dichlorvos 11282359, 17850875
Neurodegenerative Diseases inferred via Dichlorvos 16635102
Neurotoxicity Syndromes inferred via Dichlorvos 12186780
Pancreatitis inferred via Dichlorvos 16258382
Parkinson Disease, Secondary inferred via Dichlorvos 12645970
Poisoning inferred via Dichlorvos 18072136, 15303389, 17157343, 17603234, 12460839, 16036766
Polyneuropathies inferred via Dichlorvos 12563396
Prostatic Neoplasms inferred via Dichlorvos 12661182
Respiratory Insufficiency inferred via Dichlorvos 17350689, 15303389
Respiratory Sounds inferred via Dichlorvos 17119214, 16611668
Respiratory Tract Diseases inferred via Dichlorvos 17119214, 16611668
Seizures inferred via Dichlorvos 12660363, 17157343
Stomach Neoplasms inferred via Dichlorvos 11397402
Strongyloidiasis inferred via Dichlorvos 14651886
Esophageal Neoplasms inferred via dibutylnitrosamine 12706858
Liver Neoplasms inferred via dibutylnitrosamine 15881669
Urinary Bladder Neoplasms inferred via dibutylnitrosamine 12706858
Agricultural Workers' Diseases inferred via Diazinon 16487989
Dyspnea inferred via Diazinon 16487989
Hepatitis inferred via Diazinon 16487989
Infertility, Male inferred via Diazinon 16466525, 12948887
Poisoning inferred via Diazinon 17603234
Urologic Diseases inferred via Diazinon 16487989
Amnesia inferred via Desmodium gangeticum extract 16946593
Diabetes Mellitus, Experimental inferred via Desmodium gangeticum extract 17431824
Duodenal Ulcer inferred via Desmodium gangeticum extract 15991576
Inflammation inferred via Desmodium gangeticum extract 17604372, 15507346
Leishmaniasis, Visceral inferred via Desmodium gangeticum extract 1470668, 15763367, 16099649
Myocardial Infarction inferred via Desmodium gangeticum extract 15740881
Pain inferred via Desmodium gangeticum extract 15507346
Reperfusion Injury inferred via Desmodium gangeticum extract 18380926
Stomach Ulcer inferred via Desmodium gangeticum extract 15991576
Insect Bites and Stings inferred via decamethrin 15189238
Adenoma, Liver Cell inferred via DDT 12597452
Agricultural Workers' Diseases inferred via DDT 12584743, 16487989
Breast Neoplasms inferred via DDT 16792888, 12709520
Carcinoma, Hepatocellular inferred via DDT 12597452
Dyspnea inferred via DDT 16487989
Hepatitis inferred via DDT 16487989
Hepatomegaly inferred via DDT 2387028
Infertility, Male inferred via DDT 17192596, 17157474
Liver Diseases inferred via DDT 15729006
Liver Neoplasms inferred via DDT 15975961, 11948501
Neoplasms inferred via DDT 8820588
Prostatic Neoplasms inferred via DDT 12584743
Urologic Diseases inferred via DDT 16487989
Agricultural Workers' Diseases inferred via cypermethrin 16487989
Dyspnea inferred via cypermethrin 16487989
Hepatitis inferred via cypermethrin 16487989
Insect Bites and Stings inferred via cypermethrin 15189238
Liver Diseases inferred via cypermethrin 15991261
Urologic Diseases inferred via cypermethrin 16487989
Alzheimer Disease inferred via Copper 17119284, 16866297, 16325427, 16410023, 16962711, 16886094
Amyotrophic Lateral Sclerosis inferred via Copper 10694572
Anemia, Iron-Deficiency inferred via Copper 16614410
Brain Neoplasms inferred via Copper 17079463
Breast Neoplasms inferred via Copper 15986119, 17079463
Cardiomegaly inferred via Copper 17327471
Hepatitis, Chronic inferred via Copper 17338147
Hepatolenticular Degeneration inferred via Copper 17109627, 17182432, 16607473, 17276780
Kidney Failure, Chronic inferred via Copper 16518626
Learning Disorders inferred via Copper 17134702
Menkes Kinky Hair Syndrome inferred via Copper 17109627, 17268249
Neovascularization, Pathologic inferred via Copper 17308104
Prostatic Neoplasms inferred via Copper 17079463, 17308104
Schizophrenia inferred via Copper 16842975
Lung Diseases inferred via chromium hexavalent ion 16775837
Lung Neoplasms inferred via chromium hexavalent ion 16570259, 16876463
Nose Neoplasms inferred via chromium hexavalent ion 16876463
Agricultural Workers' Diseases inferred via Chlorpyrifos 11874814, 17119214, 16611668
Liver Diseases inferred via Chlorpyrifos 15991261
Respiratory Sounds inferred via Chlorpyrifos 11874814, 17119214, 16611668
Respiratory Tract Diseases inferred via Chlorpyrifos 17119214, 16611668
Hepatitis, Toxic inferred via Chlorodiphenyl (54% Chlorine) 17851650
Seizures inferred via Chlorfenvinphos 11218047
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16124888, 16227642, 15700767, 10355542, 15673190, 16097048, 16050911, 16011737
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 12795759, 61145, 12631006, 17595544, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 11566570, 15998439, 15968718, 15027814, 16227642
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 17334410, 16943688, 16221502, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 16248980, 17525996, 17557913, 18156304, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 17976157, 17805973, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 16116963
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 16964402, 17285989, 15830285
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Kidney Diseases inferred via Cadmium Chloride 16962696
Cell Transformation, Neoplastic inferred via Cadmium 17332340
Kidney Diseases inferred via Cadmium 16962696, 16322080
Prostatic Neoplasms inferred via Cadmium 17075824
Breast Neoplasms inferred via bexarotene 16818667, 16344269
Carcinoma, Non-Small-Cell Lung inferred via bexarotene 16247446
Lung Neoplasms inferred via bexarotene 17849452
Lymphoma, T-Cell, Cutaneous inferred via bexarotene 11161223
Mammary Neoplasms, Experimental inferred via bexarotene 15591091
Anophthalmos inferred via Benomyl 15907663
Eye Abnormalities inferred via Benomyl 1914497
Nervous System Malformations inferred via Benomyl 14502586
Breast Neoplasms inferred via Atropine 12762645
Poisoning inferred via Atropine 18072136
Seizures inferred via Atropine 11218047, 12660363, 17157343
Agricultural Workers' Diseases inferred via Atrazine 11874814
Infertility, Male inferred via Atrazine 12948887
Mesothelioma inferred via Atrazine 1916698
Parkinson Disease inferred via Atrazine 17218051
Respiratory Sounds inferred via Atrazine 11874814
Anemia, Sickle Cell inferred via Aspartame 11372003
Arthritis, Rheumatoid inferred via Aspartame 10777254
Dental Caries inferred via Aspartame 8955999
Dermatitis, Allergic Contact inferred via Aspartame 14996049
Erythema Nodosum inferred via Aspartame 9324739
Eyelid Diseases inferred via Aspartame 14996049
Fever inferred via Aspartame 9630831
Hypertension inferred via Aspartame 18708962
Kidney Diseases inferred via Aspartame 11409539
Migraine Disorders inferred via Aspartame 18627677, 10792367
Neoplasms inferred via Aspartame 16507461
Osteoarthritis inferred via Aspartame 9630831
Pain inferred via Aspartame 9630831
Sjogren's Syndrome inferred via Aspartame 16800424
Thrombocytopenia inferred via Aspartame 17534100
Breast Neoplasms inferred via Ascorbic Acid 16443354
Common Cold inferred via Ascorbic Acid 17323712
Diabetes Mellitus, Type 2 inferred via Ascorbic Acid 16506275
Heart Defects, Congenital inferred via Ascorbic Acid 16080930
Hernia, Diaphragmatic inferred via Ascorbic Acid 16863852, 16490937
Lung Diseases inferred via Ascorbic Acid 16863852
Lung Neoplasms inferred via Ascorbic Acid 16401635
Obesity inferred via Ascorbic Acid 17217161
Pulmonary Eosinophilia inferred via Ascorbic Acid 14606601
Retinitis Pigmentosa inferred via Ascorbic Acid 16849425
Stroke inferred via Ascorbic Acid 16517955
Alzheimer Disease inferred via Aluminum 10721010
Inflammation inferred via Aluminum 16052892
Lung Diseases inferred via Aluminum 16052892
Multiple Sclerosis, Chronic Progressive inferred via Aluminum 17086897
Multiple Sclerosis, Relapsing-Remitting inferred via Aluminum 17086897
Agricultural Workers' Diseases inferred via alachlor 11874814, 14769641
Dermatitis, Allergic Contact inferred via alachlor 8428444
Infertility, Male inferred via alachlor 16466525, 12948887, 17049205
Leukemia inferred via alachlor 14769641
Multiple Myeloma inferred via alachlor 14769641
Nose Neoplasms inferred via alachlor 16698726, 15580706, 14563481, 11127290, 16178123
Respiratory Sounds inferred via alachlor 11874814
Thyroid Neoplasms inferred via alachlor 8812207

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
APP APP / ACHE Reconstituted Complex Cottingham MG (2002)
LGTN ACHE / LGTN Invivo Gaston SM (1982)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Liang D, et al. (2009) "Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase." FEBS J. 276(1):94-108. PMID:19019080
  2. [ + ] Need AC, et al. (2009) "Pharmacogenetics of antipsychotic response in the CATIE trial: a candidate gene analysis." Eur J Hum Genet. 17(7):946-957. PMID:19156168
  3. [ + ] Bosgra S, et al. (2009) "Toxicodynamic analysis of the combined cholinesterase inhibition by paraoxon and methamidophos in human whole blood." Toxicol Appl Pharmacol. 236(1):9-15. PMID:19371630
  4. [ + ] Carvalho FA, et al. (2009) "Modulation of erythrocyte acetylcholinesterase activity and its association with G protein-band 3 interactions." J Membr Biol. 228(2):89-97. PMID:19294450
  5. [ + ] Parveen F, et al. (2009) "Acetylcholinesterase gene polymorphism and recurrent pregnancy loss." Int J Gynaecol Obstet. 106(1):68-69. PMID:19327769
  6. [ + ] Bosgra S, et al. (2009) "Toxicodynamic analysis of the inhibition of isolated human acetylcholinesterase by combinations of methamidophos and methomyl in vitro." Toxicol Appl Pharmacol. 236(1):1-8. PMID:19371631
  7. [ + ] Battisti V, et al. (2009) "Changes in acetylcholinesterase (AchE) activity in lymphocytes and whole blood in acute lymphoblastic leukemia patients." Clin Chim Acta. 402(1-2):114-118. PMID:19185568
  8. [ + ] Johnson G, et al. (2008) "Interaction of acetylcholinesterase with the G4 domain of the laminin alpha1-chain." Biochem J. 411(3):507-514. PMID:18215127
  9. [ + ] Mor I, et al. (2008) "Acetylcholinesterase-R increases germ cell apoptosis but enhances sperm motility." J Cell Mol Med. 12(2):479-495. PMID:18194455
  10. [ + ] Anderson AA, et al. (2008) "Morphoregulation by acetylcholinesterase in fibroblasts and astrocytes." J Cell Physiol. 215(1):82-100. PMID:17948252
  11. [ + ] Vlachos DG, et al. (2008) "The effect of the mode of delivery on the maternal-neonatal erythrocyte membrane acetylcholinesterase activity." Clin Biochem. 41(10-11):818-823. PMID:18454940
  12. [ + ] Xiang AC, et al. (2008) "Acetylcholinesterase in intestinal cell differentiation involves G2/M cell cycle arrest." Cell Mol Life Sci. 65(11):1768-1779. PMID:18470725
  13. [ + ] Park SE, et al. (2008) "Interactions of acetylcholinesterase with caveolin-1 and subsequently with cytochrome c are required for apoptosome formation." Carcinogenesis. 29(4):729-737. PMID:18258603
  14. [ + ] Lorke DE, et al. (2008) "In vitro oxime protection of human red blood cell acetylcholinesterase inhibited by diisopropyl-fluorophosphate." J Appl Toxicol. 28(4):422-429. PMID:18344198
  15. [ + ] Jun D, et al. (2008) "Potency of novel oximes to reactivate sarin inhibited human cholinesterases." Drug Chem Toxicol. 31(1):1-9. PMID:18161504
  16. [ + ] Petraglio G, et al. (2008) "The role of Li+, Na+, and K+ in the ligand binding inside the human acetylcholinesterase gorge." Proteins. 70(3):779-785. PMID:17729290
  17. [ + ] Scacchi R, et al. (2008) "Variability of AChE, BChE, and ChAT genes in the late-onset form of Alzheimer's disease and relationships with response to treatment with Donepezil and Rivastigmine." Am J Med Genet B Neuropsychiatr Genet. ():. PMID:18780301
  18. [ + ] Syed M, et al. (2008) "Acetylcholinesterase supports anchorage independence in colon cancer." Clin Exp Metastasis. 25(7):787-798. PMID:18612832
  19. [ + ] Toiber D, et al. (2008) "N-acetylcholinesterase-induced apoptosis in Alzheimer's disease." PLoS One. 3(9):e3108. PMID:18769671
  20. [ + ] Silveyra MX, et al. (2008) "Presenilin 1 interacts with acetylcholinesterase and alters its enzymatic activity and glycosylation." Mol Cell Biol. 28(9):2908-2919. PMID:18299393
  21. [ + ] Motamed-Khorasani A, et al. (2007) "Differentially androgen-modulated genes in ovarian epithelial cells from BRCA mutation carriers and control patients predict ovarian cancer survival and disease progression." Oncogene. 26(2):198-214. PMID:16832351
  22. [ + ] Naravaneni R, et al. (2007) "Determination of AChE levels and genotoxic effects in farmers occupationally exposed to pesticides." Hum Exp Toxicol. 26(9):723-731. PMID:17984143
  23. [ + ] Santos SC, et al. (2007) "Expression and subcellular localization of a novel nuclear acetylcholinesterase protein." J Biol Chem. 282(35):25597-25603. PMID:17606622
  24. [ + ] Sultatos LG, et al. (2007) "Concentration-dependent binding of chlorpyrifos oxon to acetylcholinesterase." Toxicol Sci. 100(1):128-135. PMID:17702992
  25. [ + ] Piccardi M, et al. (2007) "Alzheimer's disease: case-control association study of polymorphisms in ACHE, CHAT, and BCHE genes in a Sardinian sample." Am J Med Genet B Neuropsychiatr Genet. 144B(7):895-899. PMID:17503475
  26. [ + ] Schallreuter KU, et al. (2007) "Calcium-activated butyrylcholinesterase in human skin protects acetylcholinesterase against suicide inhibition by neurotoxic organophosphates." Biochem Biophys Res Commun. 355(4):1069-1074. PMID:17335779
  27. [ + ] Worek F, et al. (2007) "Reactivation of organophosphate-inhibited human AChE by combinations of obidoxime and HI 6 in vitro." J Appl Toxicol. 27(6):582-588. PMID:17370251
  28. [ + ] Gilboa-Geffen A, et al. (2007) "The thymic theme of acetylcholinesterase splice variants in myasthenia gravis." Blood. 109(10):4383-4391. PMID:17272501
  29. [ + ] Perry C, et al. (2007) "Acetylcholinesterase/C terminal binding protein interactions modify Ikaros functions, causing T lymphopenia." Leukemia. 21(7):1472-1480. PMID:17476278
  30. [ + ] Zhu H, et al. (2007) "Calcineurin mediates acetylcholinesterase expression during calcium ionophore A23187-induced HeLa cell apoptosis." Biochim Biophys Acta. 1773(4):593-602. PMID:17320203
  31. [ + ] Montenegro MF, et al. (2006) "Cholinesterases are down-expressed in human colorectal carcinoma." Cell Mol Life Sci. 63(18):2175-2182. PMID:16909200
  32. [ + ] Eggers C, et al. (2006) "Cortical acetylcholine esterase activity and ApoE4-genotype in Alzheimer disease." Neurosci Lett. 408(1):46-50. PMID:16996687
  33. [ + ] Cohen O, et al. (2006) "Comparison of polyethylene glycol-conjugated recombinant human acetylcholinesterase and serum human butyrylcholinesterase as bioscavengers of organophosphate compounds." Mol Pharmacol. 70(3):1121-1131. PMID:16801396
  34. [ + ] Tsakiris S, et al. (2006) "Erythrocyte membrane acetylcholinesterase activity in subjects with MTHFR 677C-->T genotype." Clin Chem Lab Med. 44(1):23-27. PMID:16375580
  35. [ + ] Meshorer E, et al. (2006) "Virtues and woes of AChE alternative splicing in stress-related neuropathologies." Trends Neurosci. 29(4):216-224. PMID:16516310
  36. [ + ] Montenegro MF, et al. (2006) "Acetyl- and butyrylcholinesterase activities decrease in human colon adenocarcinoma." J Mol Neurosci. 30(1-2):51-54. PMID:17192624
  37. [ + ] Silveyra MX, et al. (2006) "Altered glycosylation of acetylcholinesterase in the Creutzfeldt-Jakob cerebrospinal fluid." J Mol Neurosci. 30(1-2):65-66. PMID:17192630
  38. [ + ] Tsim KW, et al. (2006) "Transcriptional control of different acetylcholinesterase subunits in formation and maintenance of vertebrate neuromuscular junctions." J Mol Neurosci. 30(1-2):189-192. PMID:17192673
  39. [ + ] Rees TM, et al. (2005) "Memory deficits correlating with acetylcholinesterase splice shift and amyloid burden in doubly transgenic mice." Curr Alzheimer Res. 2(3):291-300. PMID:15974894
  40. [ + ] Martinez-Moreno P, et al. (2005) "Acetylcholinesterase biogenesis is impaired in lung cancer tissues." Chem Biol Interact. 157-158():359-361. PMID:16429485
  41. [ + ] Li B, et al. (2005) "Butyrylcholinesterase, paraoxonase, and albumin esterase, but not carboxylesterase, are present in human plasma." Biochem Pharmacol. 70(11):1673-1684. PMID:16213467
  42. [ + ] Mis K, et al. (2005) "Expression and distribution of acetylcholinesterase among the cellular components of the neuromuscular junction formed in human myotube in vitro." Chem Biol Interact. 157-158():29-35. PMID:16256091
  43. [ + ] Shafferman A, et al. (2005) "Functional requirements for the optimal catalytic configuration of the AChE active center." Chem Biol Interact. 157-158():123-131. PMID:16256968
  44. [ + ] Hasin Y, et al. (2005) "Analysis of genetic polymorphisms in acetylcholinesterase as reflected in different populations." Curr Alzheimer Res. 2(2):207-218. PMID:15974920
  45. [ + ] Carvalho FA, et al. (2005) "Biochemical characterization of human umbilical vein endothelial cell membrane bound acetylcholinesterase." FEBS J. 272(21):5584-5594. PMID:16262697
  46. [ + ] Bryk B, et al. (2005) "Inherited and acquired interactions between ACHE and PON1 polymorphisms modulate plasma acetylcholinesterase and paraoxonase activities." J Neurochem. 92(5):1216-1227. PMID:15715671
  47. [ + ] Benmoyal-Segal L, et al. (2005) "Acetylcholinesterase/paraoxonase interactions increase the risk of insecticide-induced Parkinson's disease." FASEB J. 19(3):452-454. PMID:15629887
  48. [ + ] Guerra M, et al. (2005) "Acetylcholinesterase and molecular interactions at the neuromuscular junction." Chem Biol Interact. 157-158():57-61. PMID:16289501
  49. [ + ] Cook LJ, et al. (2005) "Candidate gene association studies of genes involved in neuronal cholinergic transmission in Alzheimer's disease suggests choline acetyltransferase as a candidate deserving further study." Am J Med Genet B Neuropsychiatr Genet. 132B(1):5-8. PMID:15690550