AADACL1 | GeneID:429158 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 429158 Official Symbol AADACL1
Locus N/A Gene Type protein-coding
Synonyms
Full Name arylacetamide deacetylase-like 1
Description arylacetamide deacetylase-like 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23251

ID Symbol Protein Species
GeneID:57552 AADACL1 NP_065843.3 Homo sapiens
GeneID:177791 esterase NP_501702.1 Caenorhabditis elegans
GeneID:181188 esterase NP_001024899.1 Caenorhabditis elegans
GeneID:189866 Y43F8A.3 NP_507771.2 Caenorhabditis elegans
GeneID:320024 Aadacl1 NP_848887.1 Mus musculus
GeneID:429158 AADACL1 XP_426713.2 Gallus gallus
GeneID:432374 zgc:92416 NP_001002303.1 Danio rerio
GeneID:470998 AADACL1 XP_526382.2 Pan troglodytes
GeneID:488171 AADACL1 XP_545295.2 Canis lupus familiaris
GeneID:534212 AADACL1 XP_584246.3 Bos taurus
GeneID:777713 zgc:153038 NP_001071229.1 Danio rerio
GeneID:797436 LOC797436 XP_001335382.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_426713 XP_426713

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000014937 MI0001263 gga-let-7k UGAGGUAGUAGAUUGAAUAGUU
ENSGALT00000014937 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSGALT00000014937 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSGALT00000014937 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENSGALT00000014937 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENSGALT00000014937 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENSGALT00000014937 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSGALT00000014937 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSGALT00000014937 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENSGALT00000014937 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSGALT00000014937 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENSGALT00000014937 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSGALT00000014937 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSGALT00000014937 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSGALT00000014937 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENSGALT00000014937 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENSGALT00000014937 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_426713  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene