A4GNT | GeneID:429136 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 429136 Official Symbol A4GNT
Locus N/A Gene Type protein-coding
Synonyms
Full Name alpha-1,4-N-acetylglucosaminyltransferase
Description alpha-1,4-N-acetylglucosaminyltransferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 87446

ID Symbol Protein Species
GeneID:51146 A4GNT NP_057245.1 Homo sapiens
GeneID:333424 A4gnt NP_001070892.1 Mus musculus
GeneID:429136 A4GNT XP_426692.2 Gallus gallus
GeneID:460724 A4GNT XP_516775.2 Pan troglodytes
GeneID:485683 A4GNT XP_542803.2 Canis lupus familiaris
GeneID:540795 A4GNT XP_613170.1 Bos taurus
GeneID:685758 A4gnt XP_001065156.1 Rattus norvegicus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005795 Component Golgi stack
GO:0008378 Function galactosyltransferase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_426692 XP_426692

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000010653 MI0005022 bta-miR-487a AAUCAUACAGGGACAUCCAGU
ENSGALT00000010653 MI0005060 bta-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSGALT00000010653 MI0001170 gga-miR-33 GUGCAUUGUAGUUGCAUUGC
ENSGALT00000010653 MI0006985 gga-miR-33 GUGCAUUGUAGUUGCAUUGC
ENSGALT00000010653 MI0001179 gga-miR-92 UAUUGCACUUGUCCCGGCCUG
ENSGALT00000010653 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSGALT00000010653 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENSGALT00000010653 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENSGALT00000010653 MI0003126 hsa-miR-491-3p CUUAUGCAAGAUUCCCUUCUAC
ENSGALT00000010653 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSGALT00000010653 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENSGALT00000010653 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENSGALT00000010653 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSGALT00000010653 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSGALT00000010653 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENSGALT00000010653 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSGALT00000010653 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENSGALT00000010653 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSGALT00000010653 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENSGALT00000010653 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENSGALT00000010653 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_426692  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]