AADAT | GeneID:428728 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 428728 Official Symbol AADAT
Locus N/A Gene Type protein-coding
Synonyms
Full Name aminoadipate aminotransferase
Description aminoadipate aminotransferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56540

ID Symbol Protein Species
GeneID:23923 Aadat NP_035964.1 Mus musculus
GeneID:29416 Aadat NP_058889.1 Rattus norvegicus
GeneID:51166 AADAT NP_057312.1 Homo sapiens
GeneID:428728 AADAT XP_426286.2 Gallus gallus
GeneID:461601 AADAT XP_001154960.1 Pan troglodytes
GeneID:486059 AADAT XP_543185.2 Canis lupus familiaris
GeneID:508929 AADAT NP_001015551.1 Bos taurus
GeneID:520638 LOC520638 XP_598886.3 Bos taurus
GeneID:557979 LOC557979 XP_686234.3 Danio rerio
GeneID:5048716 MGG_14221 XP_001402824.1 Magnaporthe grisea

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_426286 XP_426286

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000015723 MI0005067 bta-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSGALT00000015723 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSGALT00000015723 MI0001171 gga-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSGALT00000015723 MI0001234 gga-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSGALT00000015723 MI0001259 gga-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSGALT00000015723 MI0001174 gga-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSGALT00000015723 MI0001233 gga-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSGALT00000015723 MI0001241 gga-miR-130a CAGUGCAAUAUUAAAAGGGCAU
ENSGALT00000015723 MI0001239 gga-miR-130b CAGUGCAAUAAUGAAAGGGCGU
ENSGALT00000015723 MI0001219 gga-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSGALT00000015723 MI0001242 gga-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSGALT00000015723 MI0001220 gga-miR-199 CCCAGUGUUCAGACUACCUGUUC
ENSGALT00000015723 MI0001245 gga-miR-199 CCCAGUGUUCAGACUACCUGUUC
ENSGALT00000015723 MI0001200 gga-miR-216 UAAUCUCAGCUGGCAACUGUG
ENSGALT00000015723 MI0001240 gga-miR-301 CAGUGCAAUAAUAUUGUCAAAGCAU
ENSGALT00000015723 MI0003701 gga-miR-302c* UUUAACAUGGAGGUACCUGCUG
ENSGALT00000015723 MI0001256 gga-miR-30e UGUAAACAUCCUUGACUGG
ENSGALT00000015723 MI0001194 gga-miR-32 UAUUGCACAUUACUAAGUUGC
ENSGALT00000015723 MI0001261 gga-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
ENSGALT00000015723 MI0003715 gga-miR-449 UGGCAGUGUAUGUUAGCUGGU
ENSGALT00000015723 MI0001179 gga-miR-92 UAUUGCACUUGUCCCGGCCUG
ENSGALT00000015723 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSGALT00000015723 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSGALT00000015723 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENSGALT00000015723 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSGALT00000015723 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSGALT00000015723 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENSGALT00000015723 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSGALT00000015723 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSGALT00000015723 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENSGALT00000015723 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSGALT00000015723 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSGALT00000015723 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSGALT00000015723 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENSGALT00000015723 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENSGALT00000015723 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSGALT00000015723 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSGALT00000015723 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_426286  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene