ABCF2 | GeneID:426038 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 426038 Official Symbol ABCF2
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family F (GCN20), member 2
Description ATP-binding cassette, sub-family F (GCN20), member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21408

ID Symbol Protein Species
GeneID:10061 ABCF2 NP_005683.2 Homo sapiens
GeneID:27407 Abcf2 NP_038881.1 Mus musculus
GeneID:32508 CG9281 NP_573057.1 Drosophila melanogaster
GeneID:176771 abcf-2 NP_499779.1 Caenorhabditis elegans
GeneID:311959 Abcf2 XP_231307.1 Rattus norvegicus
GeneID:336770 abcf2 NP_958472.1 Danio rerio
GeneID:426038 ABCF2 NP_001006562.1 Gallus gallus
GeneID:463887 ABCF2 XP_001139777.1 Pan troglodytes
GeneID:482806 ABCF2 XP_850220.1 Canis lupus familiaris
GeneID:513061 ABCF2 NP_001039601.1 Bos taurus
GeneID:836200 ATGCN1 NP_200887.1 Arabidopsis thaliana
GeneID:1273267 AgaP_AGAP002693 XP_312228.2 Anopheles gambiae
GeneID:4346343 Os08g0564100 NP_001062528.1 Oryza sativa
GeneID:4347924 Os09g0572400 NP_001063997.1 Oryza sativa
GeneID:100000576 LOC100000576 XP_001337123.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001006562 NP_001006562

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000021792 MI0004738 bta-miR-151 CUAGACUGAAGCUCCUUGAGG
ENSGALT00000021792 MI0001185 gga-miR-16 UAGCAGCACGUAAAUAUUGGUG
ENSGALT00000021792 MI0001222 gga-miR-16 UAGCAGCACGUAAAUAUUGGUG
ENSGALT00000021792 MI0003699 gga-miR-202 AGAGGCAUAGAGCAUGGGAAAA
ENSGALT00000021792 MI0001273 gga-miR-23b AUCACAUUGCCAGGGAUUACC
ENSGALT00000021792 MI0001275 gga-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSGALT00000021792 MI0003712 gga-miR-367 AAUUGCACUUUAGCAAUGGUG
ENSGALT00000021792 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENSGALT00000021792 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSGALT00000021792 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENSGALT00000021792 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSGALT00000021792 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSGALT00000021792 MI0003583 hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC
ENSGALT00000021792 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSGALT00000021792 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSGALT00000021792 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSGALT00000021792 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSGALT00000021792 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSGALT00000021792 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSGALT00000021792 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSGALT00000021792 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENSGALT00000021792 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENSGALT00000021792 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENSGALT00000021792 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSGALT00000021792 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSGALT00000021792 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098