ABCB6 | GeneID:425721 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 425721 Official Symbol ABCB6
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 6
Chromosome N/A
Also Known As
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_423449 XP_423449

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000038272 MI0001179 gga-miR-92 UAUUGCACUUGUCCCGGCCUG
ENSGALT00000038272 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSGALT00000038272 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENSGALT00000038272 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENSGALT00000038272 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_423449  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene