AADACL2 | GeneID:425034 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 425034 Official Symbol AADACL2
Locus N/A Gene Type protein-coding
Synonyms AADAC
Full Name arylacetamide deacetylase-like 2
Description arylacetamide deacetylase-like 2
Chromosome N/A
Also Known As arylacetamide deacetylase (esterase)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37436

ID Symbol Protein Species
GeneID:13 AADAC NP_001077.2 Homo sapiens
GeneID:57300 Aadac NP_065413.1 Rattus norvegicus
GeneID:67758 Aadac NP_075872.1 Mus musculus
GeneID:425034 AADACL2 XP_422836.2 Gallus gallus
GeneID:460785 AADAC XP_001145851.1 Pan troglodytes
GeneID:477115 AADAC XP_534309.2 Canis lupus familiaris
GeneID:519557 AADAC NP_001069259.1 Bos taurus
GeneID:100148912 LOC100148912 XP_001923714.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_422836 XP_422836

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000016884 MI0001175 gga-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSGALT00000016884 MI0003695 gga-miR-146b* CCCUAUGGAUUCAGUUCUGC
ENSGALT00000016884 MI0001184 gga-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSGALT00000016884 MI0001227 gga-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSGALT00000016884 MI0001254 gga-miR-1b UGGAAUGUUAAGAAGUAUGUA
ENSGALT00000016884 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSGALT00000016884 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSGALT00000016884 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENSGALT00000016884 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENSGALT00000016884 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENSGALT00000016884 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSGALT00000016884 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENSGALT00000016884 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSGALT00000016884 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSGALT00000016884 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSGALT00000016884 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSGALT00000016884 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSGALT00000016884 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSGALT00000016884 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENSGALT00000016884 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENSGALT00000016884 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENSGALT00000016884 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSGALT00000016884 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENSGALT00000016884 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSGALT00000016884 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSGALT00000016884 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENSGALT00000016884 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSGALT00000016884 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSGALT00000016884 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENSGALT00000016884 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene